Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD162 Recombinant Protein

Product Specifications

Background

PSGL-1 (P-Selectin glycoprotein ligand, also designated CD162), exists as a disulfide-linked homodimer. PSGL-1 is a type 1 membrane protein that localizes on the tips of microvilli of leukocytes. Its extracellular domain is rich in serines, threonines and prolines, and includes a series of 15 and 16 ecameric repeats in HL-60 and U-937 cells, and human leukocytes, respectively. Although PSGL-1 appears to be the sole receptor for P-Selectin on human hematopoietic cells, it also interacts with E-Selectin through a unique binding site. In order to bind PSGL-1 to either E-Selectin or P-Selectin, PSGL-1 must be sialylated and fucosylated. PSLG-1 is a mucin-like molecule, much like leukosialin (CD43), CD164 and CD34. These proteins belong to an emerging family of cell adhesion receptors called sialomucins, which transduce negative signals in hematopoietic cells.

CAS Number

9000-83-3

Swiss Prot

Q14242

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~53kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGCAACCGAATATGAATATCTGGATTATGACTTCCTGCCGGAAACCGAACCGCCGGAAATGCTGCGCAATAGTACCGATACCACCCCGCTGACCGGTCCGGGTACCCCTGAAAGCACCACCGTGGAACCGGCAGCACGTCGCAGTACCGGTCTGGATGCAGGTGGCGCAGTTACCGAACTGACCACCGAACTGGCCAATATGGGTAATCTGAGCACCGATAGTGCAGCCATGGAAATTCAGACCACCCAGCCGGCAGCAACCGAAGCACAGACCACCCAACCGGTTCCGACCGAAGCACAAACCACCCCGTTAGCCGCAACCGAAGCGCAGACCACCCGCCTGACCGCAACCGAAGCCCAGACCACCCCGCTTGCAGCAACCGAGGCACAGACCACACCGCCGGCAGCCACCGAAGCCCAAACCACCCAGCCTACCGGCCTGGAAGCACAGACAACCGCCCCGGCAGCCATGGAGGCACAGACAACAGCACCGGCAGCCATGGAAGCACAGACGACCCCGCCGGCAGCAATGGAAGCCCAGACAACCCAGACCACCGCCATGGAAGCGCAGACAACCGCACCGGAAGCAACCGAAGCTCAGACCACCCAGCCAACCGCAACCGAGGCCCAGACCACACCTCTGGCCGCCATGGAAGCTCTGAGCACCGAACCGAGCGCCACCGAAGCGCTGAGCATGGAACCGACCACCAAACGTGGTCTGTTCATTCCGTTCAGCGTTAGCAGTGTGACCCATAAAGGCATTCCGATGGCAGCCAGCAATCTGAGCGTTAATTATCCGGTGGGCGCACCGGATCATATTAGTGTTAAACAGTGT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

PITPNB Human shRNA Lentiviral Particle (Locus ID 23760)
TL310408V 500 µL Each

PITPNB Human shRNA Lentiviral Particle (Locus ID 23760)

Sign In for Pricing
View Details
Alexa Fluor® 647 anti-mouse CD8a
GT00282 100 µg

Alexa Fluor® 647 anti-mouse CD8a

Sign In for Pricing
View Details
Rabbit Polyclonal SMPDL3A Antibody [DyLight 488]
NBP3-00152G 0.1 mL

Rabbit Polyclonal SMPDL3A Antibody [DyLight 488]

Sign In for Pricing
View Details
HnRNP C1/C2 Recombinant Antibody, PE-Cy5 Conjugated
bsm-61267R-PE-Cy5-TR 20 µL

HnRNP C1/C2 Recombinant Antibody, PE-Cy5 Conjugated

Sign In for Pricing
View Details
Human KLKB1 siRNA
abx921852-01 15 nmol

Human KLKB1 siRNA

Sign In for Pricing
View Details
Human KLKB1 siRNA
abx921852-02 30 nmol

Human KLKB1 siRNA

Sign In for Pricing
View Details