CD162 Recombinant Protein
Product Specifications
Background
PSGL-1 (P-Selectin glycoprotein ligand, also designated CD162), exists as a disulfide-linked homodimer. PSGL-1 is a type 1 membrane protein that localizes on the tips of microvilli of leukocytes. Its extracellular domain is rich in serines, threonines and prolines, and includes a series of 15 and 16 ecameric repeats in HL-60 and U-937 cells, and human leukocytes, respectively. Although PSGL-1 appears to be the sole receptor for P-Selectin on human hematopoietic cells, it also interacts with E-Selectin through a unique binding site. In order to bind PSGL-1 to either E-Selectin or P-Selectin, PSGL-1 must be sialylated and fucosylated. PSLG-1 is a mucin-like molecule, much like leukosialin (CD43), CD164 and CD34. These proteins belong to an emerging family of cell adhesion receptors called sialomucins, which transduce negative signals in hematopoietic cells.
CAS Number
9000-83-3
Swiss Prot
Q14242
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~53kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CAGGCAACCGAATATGAATATCTGGATTATGACTTCCTGCCGGAAACCGAACCGCCGGAAATGCTGCGCAATAGTACCGATACCACCCCGCTGACCGGTCCGGGTACCCCTGAAAGCACCACCGTGGAACCGGCAGCACGTCGCAGTACCGGTCTGGATGCAGGTGGCGCAGTTACCGAACTGACCACCGAACTGGCCAATATGGGTAATCTGAGCACCGATAGTGCAGCCATGGAAATTCAGACCACCCAGCCGGCAGCAACCGAAGCACAGACCACCCAACCGGTTCCGACCGAAGCACAAACCACCCCGTTAGCCGCAACCGAAGCGCAGACCACCCGCCTGACCGCAACCGAAGCCCAGACCACCCCGCTTGCAGCAACCGAGGCACAGACCACACCGCCGGCAGCCACCGAAGCCCAAACCACCCAGCCTACCGGCCTGGAAGCACAGACAACCGCCCCGGCAGCCATGGAGGCACAGACAACAGCACCGGCAGCCATGGAAGCACAGACGACCCCGCCGGCAGCAATGGAAGCCCAGACAACCCAGACCACCGCCATGGAAGCGCAGACAACCGCACCGGAAGCAACCGAAGCTCAGACCACCCAGCCAACCGCAACCGAGGCCCAGACCACACCTCTGGCCGCCATGGAAGCTCTGAGCACCGAACCGAGCGCCACCGAAGCGCTGAGCATGGAACCGACCACCAAACGTGGTCTGTTCATTCCGTTCAGCGTTAGCAGTGTGACCCATAAAGGCATTCCGATGGCAGCCAGCAATCTGAGCGTTAATTATCCGGTGGGCGCACCGGATCATATTAGTGTTAAACAGTGT
Available Sizes
More Discoveries
Explore Other Products
Browse additional items from our catalog