Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD161 Recombinant Protein

Product Specifications

Background

CD161/KLRB1 (Killer cell lectin-like receptor subfamily B member 1, also known as CLEC5B and NKR-P1A) is a type II transmembrane protein that is expressed on the majority of Natural Killer (NK) cells, NK T cells, and some T lymphocytes. CD161/KLRB1 is also expressed on Th17 cells, promotes their generation, and modulates their function. Engagement with its ligand lectin-like transcript 1 (LLT1) inhibits NK cell function, while LLT1 and CD161/KLRB1 interaction in the presence of a TCR signal enhances IFN-gamma production by T cells. There are several different CD161 isoforms in rodents and some function as activating receptors as well.

CAS Number

9000-83-3

Swiss Prot

Q12918

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~22kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGAAAAGCAGTATTGAAAAGTGTAGCGTTGATATTCAGCAGAGTCGCAATAAAACCACCGAACGTCCGGGCCTGCTGAATTGCCCGATCTATTGGCAGCAGCTGCGTGAAAAATGCCTGCTGTTCAGCCATACCGTTAATCCGTGGAATAATAGTCTGGCCGATTGCAGTACCAAAGAAAGTAGTCTGCTGCTGATTCGTGATAAAGATGAACTGATTCATACCCAGAATCTGATTCGTGACAAAGCCATTCTGTTCTGGATTGGCCTGAACTTCAGCCTGAGCGAAAAAAATTGGAAATGGATTAATGGCAGCTTCCTGAATAGCAATGATCTGGAAATTCGTGGTGATGCAAAAGAAAATAGTTGCATTAGTATCAGCCAGACCAGTGTGTATAGTGAATATTGCAGTACCGAAATTCGTTGGATCTGTCAGAAAGAACTGACCCCGGTGCGCAATAAAGTGTATCCGGATAGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral human SPEM1 shRNA (UAS) - Lentiviral human SPEM1 shRNA (UAS) (25)
GTR15093365 1 Vial

Lentiviral human SPEM1 shRNA (UAS) - Lentiviral human SPEM1 shRNA (UAS) (25)

Sign In for Pricing
View Details
Lentiviral human DHRS2 shRNA (UAS) - Lentiviral human DHRS2 shRNA (UAS) (100)
GTR15147342 1 Vial

Lentiviral human DHRS2 shRNA (UAS) - Lentiviral human DHRS2 shRNA (UAS) (100)

Sign In for Pricing
View Details
Mouse SEMA3F/Semaphorin-3F ELISA Kit PicoKine®
EK1734 96 Well With Removable Strips

Mouse SEMA3F/Semaphorin-3F ELISA Kit PicoKine®

Sign In for Pricing
View Details
IL16 Mouse Monoclonal Antibody
orb2974718-01 50 µg

IL16 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
IL16 Mouse Monoclonal Antibody
orb2974718-02 100 µg

IL16 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
MIRacle™ mmu-miR-1947-5p miRNA Agomir/Antagomir
AM3524 2 OD, 4 OD, 50 OD

MIRacle™ mmu-miR-1947-5p miRNA Agomir/Antagomir

Sign In for Pricing
View Details