Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD159a Recombinant Protein

Product Specifications

Background

The activity of natural killer (NK) cells is regulated by members of multiple receptor families that recognize class I MHC molecules, such as the killer cell inhibitory receptor/leukocyte immunoglobulin-like receptor (KIR/LIR) family and the C-type lectin superfamily. The KIR/LIR family includes p91A (also designated pp130 or PIR-B, for paired immunoglobulin-like receptor-B) and p91B (also designated PIR-A) . p91A acts as an inhibitory receptor through interactions with SHP-1, whereas p91B acts as an activating receptor. CD94, NKG2 and Ly-49 are members of the C-type lectin superfamily of type II membrane glycoproteins. CD94 forms heterodimers with NKG2 isoforms on the surface of NK cells, whereas Ly-49 isoforms form homodimers. NKG2-D, expressed on NK cells, gdT cells and CD8+αβ T cells, is a receptor for the stress inducible protein MICA, an antigen frequently expressed in epithelial tumors.

CAS Number

9000-83-3

Swiss Prot

P26715

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CCTAGTACCCTGATTCAGCGCCATAATAATAGTAGTCTGAATACCCGCACCCAGAAAGCACGCCATTGCGGCCATTGCCCGGAAGAATGGATTACCTATAGCAATAGCTGTTATTATATCGGCAAAGAACGTCGTACCTGGGAAGAAAGCCTGCTGGCCTGTACCAGTAAAAATAGTAGTCTTCTGAGTATTGACAACGAAGAAGAAATGAAATTCCTGAGTATTATCAGTCCGAGTAGTTGGATTGGTGTGTTCCGCAATAGTAGTCATCATCCGTGGGTTACCATGAATGGTCTGGCCTTCAAACATGAAATTAAAGATAGTGATAACGCGGAACTGAATTGCGCAGTTCTGCAGGTGAATCGCCTGAAAAGTGCCCAGTGTGGTAGTAGCATTATCTATCATTGCAAACATAAGCTG

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit
MBS2603426-01 48 Well

Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit

Ask
View Details
Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit
MBS2603426-02 96 Well

Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit

Ask
View Details
Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit
MBS2603426-03 5x 96 Well

Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit

Ask
View Details
Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit
MBS2603426-04 10x 96 Well

Canine Secretory phospholipase A2 receptor antibody (PLA2R1 Ab) ELISA Kit

Ask
View Details
Rat Protease Activated Receptor 1 (PAR1) ELISA Kit
YLA1242RA-01 48 Tests

Rat Protease Activated Receptor 1 (PAR1) ELISA Kit

Ask
View Details
Rat Protease Activated Receptor 1 (PAR1) ELISA Kit
YLA1242RA-02 96 Tests

Rat Protease Activated Receptor 1 (PAR1) ELISA Kit

Ask
View Details