Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD158b2 Recombinant Protein

Product Specifications

Background

Killer cell immunoglobulin-like receptors (KIRs) are type 1 transmembrane glycoproteins expressed by natural killer cells and subsets of CD4, CD8, and γδ T cells. Analogous to the diversity of their human leucocyte antigen class I (HLA Class I) ligands, the KIR genes are polymorphic and the content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes. The KIR proteins are characterized by the number of extracellular immunoglobulin-superfamily domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack an ITIM and instead transduce activating signals. KIR proteins play an important role in the regulation of the immune response. Combinations of KIR and HLA class I variants influence susceptibility to autoimmunity and infectious disease, as well as outcomes of haematopoietic stem cell transplantation.

CAS Number

9000-83-3

Swiss Prot

P43628

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CATGAAGGCGTTCATCGCAAACCGAGTCTGCTGGCACATCCGGGTCCGCTGGTTAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGTGATGTTCGCTTCCAGCACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGCGAACATCATGATGGTGTTAGCAAAGCCAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCCGGTACCTATCGCTGCTATGGCAGTGTGACCCATAGTCCGTATCAGCTGAGTGCCCCGAGTGATCCGCTGGATATTGTTATTACCGGCCTGTATGAAAAACCGAGTCTTAGCGCCCAGCCGGGTCCGACCGTTCTGGCTGGTGAAAGTGTTACCCTGAGTTGTAGTAGCCGCAGCAGTTATGATATGTATCATCTGAGCCGCGAAGGTGAAGCCCATGAACGTCGCTTCAGCGCAGGCCCGAAAGTGAATGGCACCTTCCAGGCCGACTTCCCGCTGGGTCCGGCCACACATGGCGGTACCTATCGTTGCTTCGGCAGCTTCCGCGATAGTCCGTATGAATGGAGTAATAGCAGTGATCCGTTACTGGTGAGCGTGACCGGCAATCCGAGCAATAGTTGGCCGAGTCCGACCGAACCGAGCAGCGAAACCGGTAATCCGCGCCATCTGCAT

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

TriMethyl-Histone H4 Rabbit Monoclonal Antibody
E56G4080 100 µL

TriMethyl-Histone H4 Rabbit Monoclonal Antibody

Ask
View Details
APOBEC3G CytoSection
TS406821P5 25 Slides

APOBEC3G CytoSection

Ask
View Details
Human Relaxin (RLN) Protein
abx654931-01 10 µg

Human Relaxin (RLN) Protein

Ask
View Details
Human Relaxin (RLN) Protein
abx654931-02 50 µg

Human Relaxin (RLN) Protein

Ask
View Details
Human Relaxin (RLN) Protein
abx654931-03 100 µg

Human Relaxin (RLN) Protein

Ask
View Details
Human Relaxin (RLN) Protein
abx654931-04 200 µg

Human Relaxin (RLN) Protein

Ask
View Details