CD158b2 Recombinant Protein
Product Specifications
Background
Killer cell immunoglobulin-like receptors (KIRs) are type 1 transmembrane glycoproteins expressed by natural killer cells and subsets of CD4, CD8, and γδ T cells. Analogous to the diversity of their human leucocyte antigen class I (HLA Class I) ligands, the KIR genes are polymorphic and the content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes. The KIR proteins are characterized by the number of extracellular immunoglobulin-superfamily domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack an ITIM and instead transduce activating signals. KIR proteins play an important role in the regulation of the immune response. Combinations of KIR and HLA class I variants influence susceptibility to autoimmunity and infectious disease, as well as outcomes of haematopoietic stem cell transplantation.
CAS Number
9000-83-3
Swiss Prot
P43628
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~30kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CATGAAGGCGTTCATCGCAAACCGAGTCTGCTGGCACATCCGGGTCCGCTGGTTAAAAGCGAAGAAACCGTGATTCTGCAGTGCTGGAGTGATGTTCGCTTCCAGCACTTCCTGCTGCATCGCGAAGGCAAATTCAAAGATACCCTGCATCTGATTGGCGAACATCATGATGGTGTTAGCAAAGCCAACTTCAGCATTGGTCCGATGATGCAGGATCTGGCCGGTACCTATCGCTGCTATGGCAGTGTGACCCATAGTCCGTATCAGCTGAGTGCCCCGAGTGATCCGCTGGATATTGTTATTACCGGCCTGTATGAAAAACCGAGTCTTAGCGCCCAGCCGGGTCCGACCGTTCTGGCTGGTGAAAGTGTTACCCTGAGTTGTAGTAGCCGCAGCAGTTATGATATGTATCATCTGAGCCGCGAAGGTGAAGCCCATGAACGTCGCTTCAGCGCAGGCCCGAAAGTGAATGGCACCTTCCAGGCCGACTTCCCGCTGGGTCCGGCCACACATGGCGGTACCTATCGTTGCTTCGGCAGCTTCCGCGATAGTCCGTATGAATGGAGTAATAGCAGTGATCCGTTACTGGTGAGCGTGACCGGCAATCCGAGCAATAGTTGGCCGAGTCCGACCGAACCGAGCAGCGAAACCGGTAATCCGCGCCATCTGCAT
Available Sizes
More Discoveries
Explore Other Products
Browse additional items from our catalog