Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD158d Recombinant Protein

Product Specifications

Background

NKAT (NK-associated transcripts) gene products, known as killer immunoglobulin-like receptors or KIRs, downregulate the cytotoxicity of NK cells upon recognition of specific class I major histocompatibility complex (MHC) molecules on target cells. This family of receptors is characterized by an extracellular region with two to three immunoglobulin-superfamily domains and a cytoplasmic domain with an antigen receptor activation motif (ARAM) . KIRs and other inhibitory receptors also possess a common cytoplasmic sequence (I/VxYxxL/V) known as an ITIM (immunoreceptor tyrosine-based inhibitory motif) . The human inhibitory human killer cell immunoglobulin-like receptor 2DL4 (KIR2DL4), also referred to as 2DL4 or CD158d, triggers potent IFN-γ responses but weak cytotoxicity in resting NK cells because of the low stoichiometric association with γ

CAS Number

9000-83-3

Swiss Prot

Q99706

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~28kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TGGGCACATGTTGGTGGTCAGGATAAACCGTTCTGCAGCGCATGGCCGAGCGCCGTTGTTCCGCAGGGTGGTCATGTGACCCTGCGTTGTCATTATCGTCGTGGCTTCAATATCTTCACCCTGTATAAAAAAGACGGCGTTCCGGTTCCGGAACTGTATAATCGTATCTTCTGGAATAGCTTCCTGATTAGCCCGGTGACCCCGGCCCATGCAGGCACATATCGTTGCCGCGGCTTCCATCCGCATAGCCCGACCGAATGGAGCGCACCGAGCAATCCGCTGGTGATTATGGTTACCGGCCTGTATGAAAAACCGAGTCTGACCGCCCGTCCGGGTCCGACAGTGCGTGCAGGTGAAAATGTGACCCTGAGTTGTAGCAGCCAGAGTAGCTTCGATATCTATCATCTGAGTCGTGAAGGTGAAGCCCATGAACTGCGTCTGCCGGCAGTTCCGAGCATTAATGGCACCTTCCAGGCAGACTTCCCGCTGGGTCCGGCAACCCATGGTGAAACCTATCGCTGCTTCGGTAGCTTCCATGGTAGCCCGTATGAATGGAGCGATCCGAGCGATCCGCTGCCGGTGAGCGTGACCGGTAATCCGAGTAGCAGTTGGCCGAGCCCGACCGAGCCGAGCTTCAAAACCGGCATTGCCCGCCATCTGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MAP2K1/2 Recombinant Antibody, PerCP-Cy5.5 Conjugated
bsm-52280R-PerCP-Cy5.5 100 µL

MAP2K1/2 Recombinant Antibody, PerCP-Cy5.5 Conjugated

Sign In for Pricing
View Details
GRASP65 (GORASP1) Human siRNA Oligo Duplex (Locus ID 64689)
SR312082 1 Kit

GRASP65 (GORASP1) Human siRNA Oligo Duplex (Locus ID 64689)

Sign In for Pricing
View Details
AIP (AH Receptor-interacting Protein, Aryl-hydrocarbon Receptor-interacting Protein, HBV X-associated Protein 2, XAP-2, Immunophilin Homolog ARA9, XAP2) (AP)
MBS6129923-01 0.1 mL

AIP (AH Receptor-interacting Protein, Aryl-hydrocarbon Receptor-interacting Protein, HBV X-associated Protein 2, XAP-2, Immunophilin Homolog ARA9, XAP2) (AP)

Sign In for Pricing
View Details
AIP (AH Receptor-interacting Protein, Aryl-hydrocarbon Receptor-interacting Protein, HBV X-associated Protein 2, XAP-2, Immunophilin Homolog ARA9, XAP2) (AP)
MBS6129923-02 5x 0.1 mL

AIP (AH Receptor-interacting Protein, Aryl-hydrocarbon Receptor-interacting Protein, HBV X-associated Protein 2, XAP-2, Immunophilin Homolog ARA9, XAP2) (AP)

Sign In for Pricing
View Details
BRG1 Recombinant Mouse monoclonal Antibody
HA610205 100 µg

BRG1 Recombinant Mouse monoclonal Antibody

Sign In for Pricing
View Details
Goat Olfactory Receptor 13C5 (OR13C5) ELISA Kit
MBS7259278-01 48 Well

Goat Olfactory Receptor 13C5 (OR13C5) ELISA Kit

Sign In for Pricing
View Details