Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD155 Recombinant Protein

Product Specifications

Background

Poliovirus receptor (PVR, CD155) is an immunoglobulin-like, transmembrane glycoprotein originally described as a mediator of poliovirus attachment to cells and later identified as important in adherens junction formation. Also known as nectin-like 5 (Necl-5), PVR binds nectin-3 and interacts with integrin αvβ3 and PDGFR to regulate integrin clustering and focal contact formation at the leading edge of migrating cells. Research studies demonstrate that PVR and nectin-3 regulate contact inhibition during cell motility and proliferation in transformed 3T3 cells. Additional research indicates that PVR (CD155, Necl-5) expression may play a role in invasiveness of lung adenocarcinoma. In the immune system, CD155 plays a role in natural killer (NK) cell-mediated cytotoxicity.

CAS Number

9000-83-3

Swiss Prot

P15151

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~36kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TGGCCTCCTCCGGGTACCGGTGATGTTGTGGTTCAGGCACCGACCCAGGTGCCGGGCTTCCTGGGTGATAGTGTTACCCTGCCGTGTTATCTGCAGGTTCCGAATATGGAAGTGACCCATGTTAGTCAGCTGACCTGGGCACGCCATGGTGAAAGCGGTAGCATGGCCGTGTTCCATCAGACCCAGGGTCCGAGTTATAGCGAAAGCAAACGCCTGGAATTCGTGGCAGCCCGCCTGGGTGCAGAACTGCGTAATGCCAGTCTGCGCATGTTCGGCCTGCGCGTGGAAGATGAAGGCAATTATACCTGCCTGTTCGTTACCTTCCCGCAGGGTAGTCGTAGCGTGGATATCTGGCTGCGCGTGCTGGCCAAACCGCAGAATACCGCCGAAGTTCAGAAAGTGCAGCTGACCGGTGAACCGGTGCCGATGGCACGCTGTGTGAGCACCGGTGGTCGTCCGCCGGCACAGATTACCTGGCATAGTGATCTGGGTGGTATGCCGAATACCAGCCAGGTGCCGGGCTTCTTAAGTGGTACCGTGACCGTGACCAGTCTGTGGATTCTGGTGCCGAGCAGTCAGGTTGATGGCAAAAATGTTACCTGTAAAGTTGAACATGAGAGCTTCGAAAAACCGCAGCTGCTGACCGTGAATCTGACCGTGTATTATCCGCCGGAAGTTAGCATTAGCGGCTATGATAATAATTGGTATCTGGGCCAGAATGAAGCCACCCTGACCTGCGATGCCCGCAGTAATCCGGAACCGACCGGTTATAATTGGAGTACCACCATGGGCCCGCTGCCGCCGTTCGCAGTGGCACAAGGTGCACAGCTGCTGATTCGCCCGGTGGATAAACCGATTAATACCACCCTGATCTGTAATGTTACCAATGCACTGGGCGCACGTCAGGCCGAACTGACCGTTCAGGTTAAAGAAGGTCCGCCGAGTGAACATAGTGGTATTAGCCGTAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

L-371, 257
MBS3845650-01 5 mg

L-371, 257

Sign In for Pricing
View Details
L-371, 257
MBS3845650-02 10 mg

L-371, 257

Sign In for Pricing
View Details
L-371, 257
MBS3845650-03 50 mg

L-371, 257

Sign In for Pricing
View Details
L-371, 257
MBS3845650-04 100 mg

L-371, 257

Sign In for Pricing
View Details
L-371, 257
MBS3845650-05 5x 100 mg

L-371, 257

Sign In for Pricing
View Details
RPL7P3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
41889061 1.0 µg DNA

RPL7P3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details