CD154 Recombinant Protein

CD40 ligand (CD40L), also known as CD154, TRAP, and gp39, is the ligand for the TNF receptor family member CD40. CD40L is expressed either as a soluble cytokine or as a homotrimeric transmembrane protein. CD40L primarily expressed on the surface of T-cells, but has also been reported in blood platelets, mast cells, basophils, NK cells, and B-cells. It plays an important role in stimulating B-cell cell proliferation and survival and promotes immunoglobulin class switching and secretion of IgE. Signals generated by CD40 vary depending on cell type and include activation of MAPK pathways as well as NF-κB. Mutations within the CD40L gene are associated with X-linked hyper-IgM syndrome characterized by high serum levels of IgM and decreased levels of other isotypes. The CD40L/CD40 pathway is an important area of interest in the study of cancer, vascular diseases, and inflammatory disorders.

CATCGTCGCCTGGATAAAATTGAAGATGAACGTAATCTGCATGAAGACTTCGTGTTCATGAAAACCATTCAGCGCTGCAATACCGGTGAACGTAGTCTGAGTCTGCTGAATTGTGAAGAAATTAAAAGTCAGTTCGAGGGCTTCGTTAAAGATATTATGCTGAATAAAGAGGAGACCAAAAAAGAAAATAGCTTCGAAATGCAGAAGGGCGATCAGAATCCGCAGATTGCAGCCCATGTTATTAGTGAAGCAAGTAGTAAAACCACCAGCGTTCTGCAGTGGGCCGAAAAAGGTTATTATACCATGAGCAATAACCTGGTGACCCTGGAAAATGGCAAACAGCTGACCGTGAAACGTCAGGGCCTGTATTATATCTATGCCCAGGTTACCTTCTGCAGCAATCGCGAAGCCAGTAGCCAGGCCCCGTTCATTGCCAGTCTGTGTCTGAAAAGCCCGGGTCGCTTCGAACGTATTCTGCTGCGCGCCGCCAATACCCATAGCAGTGCAAAACCGTGTGGCCAGCAGAGCATTCATCTGGGTGGCGTGTTCGAACTGCAGCCGGGCGCAAGCGTGTTCGTTAATGTGACCGATCCGAGCCAGGTTAGCCATGGTACCGGCTTCACCAGCTTCGGTCTGCTGAAACTG