Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD151 Recombinant Protein

Product Specifications

Background

CD151 (PETA-3, SFA-1) is a member of the evolutionarily conserved tetraspanin family of multipass glycoproteins (TM4SF), highlighted by four transmembrane domains, two extracellular loops, and N/C-termini that reside within the cytoplasm. Identified as the first member of the tetraspanin family to be implicated in tumorigenesis, research studies have demonstrated that CD151 participates in tumor neovascularization, tumor cell cell invasion, and cell adhesion. Furthermore, a positive correlation exists between CD151 expression levels and poor prognosis for tumors of the lung, kidney, and prostate. CD151 is localized predominantly to the plasma membrane and research studies have demonstrated that CD151 exerts its pro-tumorigenic effects, in part, through the modulation of laminin-binding integrins and oncogenic receptor tyrosine kinases, such as c-Met and EGFR.

CAS Number

9000-83-3

Swiss Prot

P48509

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTTATTACCAGCAGCTGAATACCGAACTGAAAGAAAATCTGAAAGATACCATGACCAAACGTTATCATCAGCCGGGCCATGAAGCCGTTACCAGCGCCGTTGATCAGCTGCAGCAGGAATTCCATTGCTGCGGTAGTAATAATAGTCAGGATTGGCGCGATAGCGAATGGATTCGTAGTCAGGAAGCCGGTGGTCGCGTGGTGCCGGATAGCTGTTGTAAAACCGTTGTGGCCCTGTGTGGCCAGCGCGATCATGCCAGCAATATCTATAAAGTGGAAGGCGGTTGCATTACCAAACTGGAAACCTTCATTCAGGAACATCTGCGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Phospholipase A2 Receptor 1 (PLA2R1)
152014 200 µL

Phospholipase A2 Receptor 1 (PLA2R1)

Sign In for Pricing
View Details
Gm14483 Protein Vector (Mouse) (pPM-C-HA)
PV183288 500 ng

Gm14483 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
TBX22 Blocking Peptide
CBP3410-01 1 mg

TBX22 Blocking Peptide

Sign In for Pricing
View Details
TBX22 Blocking Peptide
CBP3410-02 5 mg

TBX22 Blocking Peptide

Sign In for Pricing
View Details
Human MIA1 ELISA Kit
orb440770-01 48 Tests

Human MIA1 ELISA Kit

Sign In for Pricing
View Details
Human MIA1 ELISA Kit
orb440770-02 96 Tests

Human MIA1 ELISA Kit

Sign In for Pricing
View Details