Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD140a Recombinant Protein

Product Specifications

Background

Platelet derived growth factor (PDGF) family proteins exist as several disulphide-bonded, dimeric isoforms (PDGF AA, PDGF AB, PDGF BB, PDGF CC, and PDGF DD) that bind in a specific pattern to two closely related receptor tyrosine kinases, PDGF receptor α (PDGFRα) and PDGF receptor β (PDGFRβ) . PDGFRα and PDGFRβ share 75% to 85% sequence homology between their two intracellular kinase domains, while the kinase insert and carboxy-terminal tail regions display a lower level (27% to 28%) of homology. PDGFRα homodimers bind all PDGF isoforms except those containing PDGF D. PDGFRβ homodimers bind PDGF BB and DD isoforms, as well as the PDGF AB heterodimer. The heteromeric PDGF receptor α/β binds PDGF B, C, and D homodimers, as well as the PDGF AB heterodimer. PDGFRα and PDGFRβ can each form heterodimers with EGFR, which is also activated by PDGF. Various cells differ in the total number of receptors present and in the receptor subunit composition, which may account for responsive differences among cell types to PDGF binding. Ligand binding induces receptor dimerization and autophosphorylation, followed by binding and activation of cytoplasmic SH2 domain-containing signal transduction molecules, such as GRB2, Src, GAP, PI3 kinase, PLCγ, and NCK. A number of different signaling pathways are initiated by activated PDGF receptors and lead to control of cell growth, actin reorganization, migration, and differentiation. Tyr751 in the kinase-insert region of PDGFRβ is the docking site for PI3 kinase. Phosphorylated pentapeptides derived from Tyr751 of PDGFRβ (pTyr751-Val-Pro-Met-Leu) inhibit the association of the carboxy-terminal SH2 domain of the p85 subunit of PI3 kinase with PDGFR. Tyr740 is also required for PDGFRβ-mediated PI3 kinase activation.

CAS Number

9000-83-3

Swiss Prot

P16234

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~66kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGCTGAGCCTGCCGAGTATTCTGCCGAATGAAAATGAAAAAGTTGTTCAGCTGAACAGTAGCTTCAGTCTGCGCTGCTTCGGTGAAAGCGAAGTTAGTTGGCAGTATCCGATGAGTGAAGAAGAAAGCAGCGATGTTGAAATTCGCAATGAAGAAAATAACAGCGGCCTGTTCGTTACCGTGCTGGAAGTGAGTAGTGCAAGTGCCGCACATACCGGTCTGTATACCTGCTATTATAATCATACCCAGACCGAAGAAAATGAACTGGAAGGTCGCCATATCTATATCTATGTTCCGGATCCGGATGTGGCATTCGTGCCGCTGGGTATGACCGATTATCTGGTTATTGTGGAAGATGATGATAGCGCAATTATTCCGTGCCGTACCACCGATCCGGAAACACCTGTTACCCTGCATAATAGTGAAGGTGTTGTTCCGGCCAGCTATGATAGTCGTCAGGGCTTCAATGGCACCTTCACCGTTGGCCCGTATATCTGTGAAGCAACCGTGAAAGGTAAAAAATTCCAGACCATTCCGTTCAATGTGTATGCCCTGAAAGCCACCAGTGAACTGGATCTGGAAATGGAAGCACTGAAAACCGTGTATAAAAGTGGCGAAACCATTGTTGTTACCTGCGCCGTGTTCAATAATGAAGTGGTGGATCTGCAGTGGACCTATCCGGGCGAAGTGAAAGGTAAGGGTATTACCATGCTGGAAGAAATTAAAGTGCCGAGCATTAAACTGGTGTATACCCTGACCGTTCCGGAAGCCACCGTTAAAGATAGTGGTGATTATGAATGTGCAGCACGTCAGGCCACCCGCGAAGTTAAAGAAATGAAAAAAGTGACCATCAGTGTTCATGAAAAAGGCTTCATTGAAATTAAGCCGACCTTCAGTCAGCTGGAAGCCGTTAATCTGCATGAAGTTAAACACTTCGTTGTGGAAGTTCGTGCATATCCGCCGCCGCGCATTAGCTGGCTGAAAAATAATCTGACCCTGATTGAAAATCTGACCGAAATTACCACCGATGTTGAAAAAATTCAGGAAATTCGTTACCGTAGTAAACTGAAACTGATTCGCGCCAAAGAAGAAGATAGCGGTCATTATACCATTGTTGCCCAGAATGAAGATGCCGTTAAAAGCTATACCTTCGAACTGCTGACCCAGGTGCCGAGCAGTATTCTGGATCTGGTGGATGATCATCATGGTAGCACCGGTGGCCAGACCGTTCGCTGTACCGCAGAAGGCACCCCGCTGCCGGATATTGAATGGATGATCTGTAAAGATATCAAGAAATGTAACAACGAGACCAGTTGGACCATTCTGGCCAATAATGTGAGTAATATTATCACCGAAATCCATAGTCGTGATCGTAGTACCGTTGAAGGTCGCGTTACCTTCGCAAAAGTGGAAGAAACCATTGCCGTGCGTTGCCTGGCCAAAAATCTGCTGGGCGCAGAAAATCGTGAACTGAAACTGGTTGCACCGACCCTGCGCAGCGAACTGACCGTTGCC

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

SELPLG Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)
43337064 1.0 µg DNA

SELPLG Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)

Ask
View Details
Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)
MBS1072692-01 0.02 mg (E-Coli)

Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)

Ask
View Details
Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)
MBS1072692-02 0.02 mg (Yeast)

Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)

Ask
View Details
Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)
MBS1072692-03 0.1 mg (E-Coli)

Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)

Ask
View Details
Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)
MBS1072692-04 0.1 mg (Yeast)

Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)

Ask
View Details
Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)
MBS1072692-05 0.02 mg (Baculovirus)

Recombinant Xanthobacter autotrophicus UDP-N-acetylmuramate--L-alanine ligase (murC)

Ask
View Details