Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD133 Recombinant Protein

Product Specifications

Background

CD133, also known as Prominin, was first described as a cell surface marker recognized by monoclonal antibody AC133 on putative hematopoietic stem cells. Subsequent cDNA cloning indicated that CD133 is a five-transmembrane protein with a predicated molecular weight of 97 kDa. Due to heavy glycosylation, its apparent molecular weight is 130 kDa as determined by SDS-PAGE analysis. Besides blood stem cells, CD133 is expressed on and used to isolate other stem cells, including cancer stem cells. A deletion mutation in CD133 produces aberrant protein localization and may result in retinal degeneration in humans.

CAS Number

9000-83-3

Swiss Prot

O43490

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~31kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTGCAAATGTGGAAAAACTGATCTGTGAACCGTATACCAGTAAAGAACTGTTCCGCGTTCTGGATACCCCGTATCTGCTGAATGAAGATTGGGAATATTATCTGAGTGGTAAACTGTTCAATAAGAGTAAAATGAAGCTGACCTTCGAACAGGTGTATAGCGATTGTAAAAAAAATCGCGGTACCTATGGCACCCTGCATCTGCAGAATAGCTTCAATATTAGTGAACATCTGAACATTAACGAGCATACCGGCAGTATTAGCAGCGAACTGGAAAGTCTGAAAGTGAATCTGAATATCTTCCTGCTGGGCGCAGCCGGTCGTAAAAATCTGCAGGACTTCGCCGCCTGCGGCATTGATCGTATGAATTATGATAGTTATCTGGCCCAGACCGGCAAAAGTCCGGCCGGCGTTAATCTGCTGAGCTTCGCATACGATCTGGAAGCAAAAGCCAATAGCCTGCCGCCGGGCAATCTGCGCAATAGCCTGAAACGCGATGCCCAGACCATTAAAACCATTCATCAGCAGCGCGTGCTGCCGATTGAACAGAGCCTGAGCACCCTGTATCAGAGCGTTAAAATTCTGCAGCGTACCGGCAATGGCCTGCTGGAACGCGTTACCCGTATTCTGGCCAGCCTGGACTTCGCCCAGAACTTCATTACCAATAATACCAGTAGTGTTATCATCGAAGAAACCAAAAAATACGGCCGTACCATTATTGGCTACTTCGAACATTATCTGCAGTGGATTGAATTCAGTATTAGTGAAAAAGTGGCAAGCTGCAAACCGGTGGCCACCGCCCTGGATACCGCAGTGGATGTGTTCCTGTGTAGCTATATTATTGATCCGCTGAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

ACAD11 Recombinant Protein (Human)
RP036391 100 µg

ACAD11 Recombinant Protein (Human)

Sign In for Pricing
View Details
D15Ertd621e sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4103604 1.0 µg DNA

D15Ertd621e sgRNA CRISPR Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
LINGO, Phosphorylated (1, Phosphorylated (pS596) (LRRN6A, Lingo1, Lern1, Lrrn6a, Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1, Leucine-rich repeat neuronal protein 1, Leucine-rich repeat neuronal protei
MBS6316329-01 0.2 mL

LINGO, Phosphorylated (1, Phosphorylated (pS596) (LRRN6A, Lingo1, Lern1, Lrrn6a, Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1, Leucine-rich repeat neuronal protein 1, Leucine-rich repeat neuronal protei

Sign In for Pricing
View Details
LINGO, Phosphorylated (1, Phosphorylated (pS596) (LRRN6A, Lingo1, Lern1, Lrrn6a, Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1, Leucine-rich repeat neuronal protein 1, Leucine-rich repeat neuronal protei
MBS6316329-02 5x 0.2 mL

LINGO, Phosphorylated (1, Phosphorylated (pS596) (LRRN6A, Lingo1, Lern1, Lrrn6a, Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1, Leucine-rich repeat neuronal protein 1, Leucine-rich repeat neuronal protei

Sign In for Pricing
View Details
Mouse Mtx1 qPCR Primer Pair
QM17322S 200 Tests

Mouse Mtx1 qPCR Primer Pair

Sign In for Pricing
View Details
GABRR1, NT (GABRR1, Gamma-aminobutyric acid receptor subunit rho-1, GABA(A) receptor subunit rho-1, GABA(C) receptor) (MaxLight 490)
MBS6300923-01 0.1 mL

GABRR1, NT (GABRR1, Gamma-aminobutyric acid receptor subunit rho-1, GABA(A) receptor subunit rho-1, GABA(C) receptor) (MaxLight 490)

Sign In for Pricing
View Details