Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD133 Recombinant Protein

Product Specifications

Background

CD133, also known as Prominin, was first described as a cell surface marker recognized by monoclonal antibody AC133 on putative hematopoietic stem cells. Subsequent cDNA cloning indicated that CD133 is a five-transmembrane protein with a predicated molecular weight of 97 kDa. Due to heavy glycosylation, its apparent molecular weight is 130 kDa as determined by SDS-PAGE analysis. Besides blood stem cells, CD133 is expressed on and used to isolate other stem cells, including cancer stem cells. A deletion mutation in CD133 produces aberrant protein localization and may result in retinal degeneration in humans.

CAS Number

9000-83-3

Swiss Prot

O43490

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~31kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTGCAAATGTGGAAAAACTGATCTGTGAACCGTATACCAGTAAAGAACTGTTCCGCGTTCTGGATACCCCGTATCTGCTGAATGAAGATTGGGAATATTATCTGAGTGGTAAACTGTTCAATAAGAGTAAAATGAAGCTGACCTTCGAACAGGTGTATAGCGATTGTAAAAAAAATCGCGGTACCTATGGCACCCTGCATCTGCAGAATAGCTTCAATATTAGTGAACATCTGAACATTAACGAGCATACCGGCAGTATTAGCAGCGAACTGGAAAGTCTGAAAGTGAATCTGAATATCTTCCTGCTGGGCGCAGCCGGTCGTAAAAATCTGCAGGACTTCGCCGCCTGCGGCATTGATCGTATGAATTATGATAGTTATCTGGCCCAGACCGGCAAAAGTCCGGCCGGCGTTAATCTGCTGAGCTTCGCATACGATCTGGAAGCAAAAGCCAATAGCCTGCCGCCGGGCAATCTGCGCAATAGCCTGAAACGCGATGCCCAGACCATTAAAACCATTCATCAGCAGCGCGTGCTGCCGATTGAACAGAGCCTGAGCACCCTGTATCAGAGCGTTAAAATTCTGCAGCGTACCGGCAATGGCCTGCTGGAACGCGTTACCCGTATTCTGGCCAGCCTGGACTTCGCCCAGAACTTCATTACCAATAATACCAGTAGTGTTATCATCGAAGAAACCAAAAAATACGGCCGTACCATTATTGGCTACTTCGAACATTATCTGCAGTGGATTGAATTCAGTATTAGTGAAAAAGTGGCAAGCTGCAAACCGGTGGCCACCGCCCTGGATACCGCAGTGGATGTGTTCCTGTGTAGCTATATTATTGATCCGCTGAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Neuron-specific protein family member 2, Nsg2 ELISA KIT
ELI-44448m 96 Tests

Mouse Neuron-specific protein family member 2, Nsg2 ELISA KIT

Sign In for Pricing
View Details
Rat Monoclonal NKG2A/CD159a/KLRC1 Antibody (705829) [DyLight 350]
FAB6867D 0.1 mL

Rat Monoclonal NKG2A/CD159a/KLRC1 Antibody (705829) [DyLight 350]

Sign In for Pricing
View Details
MMP9 Rabbit Polyclonal Antibody
E53P10614 100 µL

MMP9 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Syndig1 3'UTR GFP Stable Cell Line
TU271462 1.0 mL

Syndig1 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Nfic Rat Pre-designed siRNA Set A
HY-RS27909 1 Set

Nfic Rat Pre-designed siRNA Set A

Sign In for Pricing
View Details
Creg2 Mouse qPCR Primer Pair (NM_170597)
MP202286 200 Reactions

Creg2 Mouse qPCR Primer Pair (NM_170597)

Sign In for Pricing
View Details