Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD132 Recombinant Protein

Product Specifications

Background

The IL-2 receptor is a multicomponent complex consisting of three subunits, a, b and g, each of which is required for high affinity binding of IL-2. The a chain functions primarily in binding IL-2, whereas the b and g chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain high affinity ligand binding cytokine receptors. However, it is now well established that the IL-2R g chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Ra and IL-7Ra respectively, while the common subunit is referred to as gc. Although the common g chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own.There is evidence that the gc chain is also a subunit of IL-13R.

CAS Number

9000-83-3

Swiss Prot

P31785

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGAATACCACCATTCTGACCCCGAATGGTAATGAAGATACCACCGCCGACTTCTTCCTGACCACCATGCCGACCGATAGCCTGAGCGTTAGCACCCTGCCGCTGCCGGAAGTTCAGTGCTTCGTGTTCAATGTGGAATATATGAATTGCACCTGGAATAGTAGCAGCGAACCGCAGCCGACCAATCTGACCCTGCATTATTGGTATAAAAATAGTGATAACGACAAGGTTCAGAAATGCAGCCATTATCTGTTCAGCGAAGAAATTACCAGCGGTTGCCAGCTGCAGAAAAAAGAAATTCATCTGTATCAGACCTTCGTGGTGCAGCTGCAGGATCCGCGTGAACCGCGTCGCCAGGCCACCCAAATGCTGAAACTGCAGAATCTGGTGATTCCGTGGGCACCGGAAAATCTGACCTTACATAAACTGAGTGAAAGCCAGCTGGAACTGAATTGGAATAATCGCTTCCTGAATCATTGCCTGGAACATCTGGTTCAGTATCGTACCGATTGGGATCATAGTTGGACCGAACAGAGCGTTGATTATCGCCATAAATTCAGTCTGCCGAGTGTTGATGGTCAGAAACGCTATACCTTCCGTGTGCGCAGTCGCTTCAATCCGCTGTGCGGTAGCGCACAGCATTGGAGTGAATGGAGCCATCCGATTCATTGGGGTAGTAATACCAGCAAAGAAAATCCGTTCCTGTTCGCCCTGGAAGCC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

PRDX6 Conjugated Antibody
MBS9457081-01 0.1 mL (Biotin)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details
PRDX6 Conjugated Antibody
MBS9457081-02 0.1 mL (AF350)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details
PRDX6 Conjugated Antibody
MBS9457081-03 0.1 mL (AF405)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details
PRDX6 Conjugated Antibody
MBS9457081-04 0.1 mL (AF488)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details
PRDX6 Conjugated Antibody
MBS9457081-05 0.1 mL (AF555)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details
PRDX6 Conjugated Antibody
MBS9457081-06 0.1 mL (AF594)

PRDX6 Conjugated Antibody

Sign In for Pricing
View Details