CD132 Recombinant Protein
Product Specifications
Background
The IL-2 receptor is a multicomponent complex consisting of three subunits, a, b and g, each of which is required for high affinity binding of IL-2. The a chain functions primarily in binding IL-2, whereas the b and g chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain high affinity ligand binding cytokine receptors. However, it is now well established that the IL-2R g chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Ra and IL-7Ra respectively, while the common subunit is referred to as gc. Although the common g chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own.There is evidence that the gc chain is also a subunit of IL-13R.
CAS Number
9000-83-3
Swiss Prot
P31785
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~30kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CTGAATACCACCATTCTGACCCCGAATGGTAATGAAGATACCACCGCCGACTTCTTCCTGACCACCATGCCGACCGATAGCCTGAGCGTTAGCACCCTGCCGCTGCCGGAAGTTCAGTGCTTCGTGTTCAATGTGGAATATATGAATTGCACCTGGAATAGTAGCAGCGAACCGCAGCCGACCAATCTGACCCTGCATTATTGGTATAAAAATAGTGATAACGACAAGGTTCAGAAATGCAGCCATTATCTGTTCAGCGAAGAAATTACCAGCGGTTGCCAGCTGCAGAAAAAAGAAATTCATCTGTATCAGACCTTCGTGGTGCAGCTGCAGGATCCGCGTGAACCGCGTCGCCAGGCCACCCAAATGCTGAAACTGCAGAATCTGGTGATTCCGTGGGCACCGGAAAATCTGACCTTACATAAACTGAGTGAAAGCCAGCTGGAACTGAATTGGAATAATCGCTTCCTGAATCATTGCCTGGAACATCTGGTTCAGTATCGTACCGATTGGGATCATAGTTGGACCGAACAGAGCGTTGATTATCGCCATAAATTCAGTCTGCCGAGTGTTGATGGTCAGAAACGCTATACCTTCCGTGTGCGCAGTCGCTTCAATCCGCTGTGCGGTAGCGCACAGCATTGGAGTGAATGGAGCCATCCGATTCATTGGGGTAGTAATACCAGCAAAGAAAATCCGTTCCTGTTCGCCCTGGAAGCC
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items