Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD129/IL9R Recombinant Protein

Product Specifications

Background

Interleukin-9 (IL-9) functions to support the growth of helper T cells, megakaryoblastic leukemia cells, fetal thymocytes, erythroid and myeloid precursors and mast cells. The murine IL-9 receptor has been identified as a protein expressed on a T cell clone. Both the murine and human IL-9 receptor cDNAs have been isolated by expression cloning from the murine T cell clone TS1 and the human megakaryoblastic leukemia cell line MO7E, respectively. In addition, the cloning and analysis of the complete human IL-9 receptor genomic DNA has been reported. In this latter study, the IL-9R gene was shown to consist of 10 exons expressed over approximately 13.7 kb of DNA.

CAS Number

9000-83-3

Swiss Prot

Q01113

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTGTGACCGGTGAAGGTCAGGGTCCGCGTAGCCGTACCTTCACCTGTCTGACCAATAATATTCTGCGCATTGATTGCCATTGGAGCGCCCCGGAACTGGGTCAGGGTAGCAGTCCGTGGCTGCTGTTCACCAGCAATCAGGCCCCGGGTGGTACCCATAAATGCATTCTGCGTGGCAGCGAATGCACCGTTGTGCTGCCGCCGGAAGCCGTGCTGGTTCCGAGTGATAACTTCACCATTACCTTCCATCATTGCATGAGTGGTCGTGAACAGGTTAGTCTGGTTGATCCGGAATATCTGCCGCGTCGTCATGTTAAACTGGATCCGCCGAGTGATCTGCAGAGCAATATTAGTAGCGGCCATTGCATTCTGACCTGGAGCATTAGCCCGGCCCTGGAACCGATGACCACCCTGCTGAGTTATGAACTGGCCTTCAAAAAACAGGAAGAAGCCTGGGAACAGGCACAGCATCGTGATCATATTGTTGGTGTGACCTGGCTGATTCTGGAAGCCTTCGAACTGGATCCGGGCTTCATTCATGAAGCCCGTCTGCGCGTTCAGATGGCAACCCTGGAAGATGATGTTGTGGAAGAAGAACGTTATACCGGCCAGTGGAGTGAATGGAGCCAGCCGGTGTGCTTCCAGGCACCGCAGCGTCAGGGCCCGCTGATTCCGCCTTGGGGTTGGCCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Transmembrane Protein 27 ELISA Kit
IMSTMEM27KT 1 Each

Mouse Transmembrane Protein 27 ELISA Kit

Sign In for Pricing
View Details
Recombinant Rotavirus B Non-structural protein 1
MBS1330105-01 0.05 mg (E-Coli)

Recombinant Rotavirus B Non-structural protein 1

Sign In for Pricing
View Details
Recombinant Rotavirus B Non-structural protein 1
MBS1330105-02 0.05 mg (Yeast)

Recombinant Rotavirus B Non-structural protein 1

Sign In for Pricing
View Details
Recombinant Rotavirus B Non-structural protein 1
MBS1330105-03 0.05 mg (Baculovirus)

Recombinant Rotavirus B Non-structural protein 1

Sign In for Pricing
View Details
Recombinant Rotavirus B Non-structural protein 1
MBS1330105-04 0.2 mg (E-Coli)

Recombinant Rotavirus B Non-structural protein 1

Sign In for Pricing
View Details
Recombinant Rotavirus B Non-structural protein 1
MBS1330105-05 0.5 mg (E-Coli)

Recombinant Rotavirus B Non-structural protein 1

Sign In for Pricing
View Details