Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD126 Recombinant Protein

Product Specifications

Background

The IL-6 receptor is a heterodimeric complex that consists of a ligand-binding IL-6 receptor α (IL-6Rα) subunit and a signaling component, gp130. Binding of IL-6 to IL-6Rα results in dimerization of receptor with gp130 and subsequent STAT3 activation (1) . IL-6Rα is cleaved from the cell surface by ADAM17. In humans, soluble IL-6Rα is also generated via alternatively spliced mRNA. Soluble IL-6Rα binds to IL-6 and can stimulate signaling via membrane bound gp130 in a process known as “trans-signaling”. It is through trans-signaling that IL-6 stimulates cells that do not express membrane bound IL-6Rα.

CAS Number

9000-83-3

Swiss Prot

P08887

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~44kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGGCTCCTCGTCGCTGTCCGGCCCAGGAAGTTGCCCGTGGTGTGCTGACCAGCCTGCCGGGTGATAGCGTTACCCTGACCTGCCCGGGCGTTGAACCGGAAGATAATGCAACCGTTCATTGGGTGCTGCGTAAACCGGCCGCAGGCAGCCATCCGAGCCGTTGGGCTGGTATGGGTCGCCGTCTGCTGCTGCGCAGCGTGCAGCTGCATGATAGCGGCAATTATAGTTGCTATCGTGCCGGTCGCCCGGCAGGCACCGTTCATCTGCTGGTGGATGTGCCGCCGGAAGAACCGCAGCTGAGCTGCTTCCGCAAAAGCCCGCTGAGTAATGTGGTGTGCGAATGGGGCCCGCGTAGTACCCCGAGTCTGACCACCAAAGCCGTTCTGCTGGTGCGCAAATTCCAGAATAGCCCGGCCGAAGACTTCCAGGAACCGTGCCAGTATAGTCAGGAAAGTCAGAAATTCAGTTGCCAGCTGGCAGTGCCGGAAGGCGATAGCAGCTTCTATATTGTGAGTATGTGTGTTGCCAGCAGCGTTGGTAGCAAATTCAGTAAAACACAAACCTTCCAGGGTTGTGGCATTCTGCAGCCGGATCCGCCGGCCAATATTACCGTTACCGCAGTTGCCCGCAATCCGCGCTGGCTGAGTGTGACCTGGCAGGATCCGCATAGCTGGAATAGCAGCTTCTACCGCCTGCGCTTCGAACTGCGTTATCGCGCAGAACGCAGTAAAACCTTCACCACCTGGATGGTTAAAGATCTGCAGCATCATTGCGTGATTCATGATGCATGGAGTGGCCTGCGTCATGTGGTTCAGCTGCGCGCACAGGAAGAATTCGGCCAGGGTGAATGGAGTGAATGGAGCCCGGAAGCAATGGGCACCCCGTGGACCGAAAGCCGCAGCCCTCCGGCTGAAAATGAAGTGAGCACCCCGATGCAGGCACTGACCACCAATAAAGATGATGATAATATTCTGTTCCGCGATAGCGCCAATGCCACCAGTCTGCCGGTTCAGGATAGTAGCAGCGTGCCGCTGCCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ATAT1 Protein Vector (Human) (pPM-N-D-C-HA)
PV324624 500 ng

ATAT1 Protein Vector (Human) (pPM-N-D-C-HA)

Sign In for Pricing
View Details
Anti-REP15 Antibody Picoband® (Biotine Conjugate)
A14074-1-Biotin 100 µg/Vial

Anti-REP15 Antibody Picoband® (Biotine Conjugate)

Sign In for Pricing
View Details
Mouse Anti Human CD8-Biotinylated
MBS140035-01 0.5 mg

Mouse Anti Human CD8-Biotinylated

Sign In for Pricing
View Details
Mouse Anti Human CD8-Biotinylated
MBS140035-02 1 mg

Mouse Anti Human CD8-Biotinylated

Sign In for Pricing
View Details
Mouse Anti Human CD8-Biotinylated
MBS140035-03 5x 1 mg

Mouse Anti Human CD8-Biotinylated

Sign In for Pricing
View Details
Human AGP1/alpha 1 acid glycoprotein ELISA Kit
orb381144 96 Tests

Human AGP1/alpha 1 acid glycoprotein ELISA Kit

Sign In for Pricing
View Details