Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD119 Recombinant Protein

Product Specifications

Background

IFN-γ plays key roles in both the innate and adaptive immune response. IFN-γ activates the cytotoxic activity of innate immune cells, such as macrophages and NK cells. IFN-γ production by NK cells and antigen presenting cells (APCs) promotes cell-mediated adaptive immunity by inducing IFN-γ production by T lymphocytes, increasing class I and class II MHC expression, and enhancing peptide antigen presentation. The anti-viral activity of IFN-γ is due to its induction of PKR and other regulatory proteins. Binding of IFN-γ to the IFNGR1/IFNGR2 complex promotes dimerization of the receptor complexes to form the (IFNGR1/IFNGR2) 2 -IFN-γ dimer. Binding induces a conformational change in receptor intracellular domains and signaling involves Jak1, Jak2, and Stat1. The critical role of IFN-γ in amplification of immune surveillance and function is supported by increased susceptibility to pathogen infection by IFN-γ or IFNGR knockout mice and in humans with inactivating mutations in IFNGR1 or IFNGR2. IFN-γ also appears to have a role in atherosclerosis.

CAS Number

9000-83-3

Swiss Prot

P15260

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAATGGGTACCGCCGATCTGGGTCCGAGCAGTGTGCCGACCCCGACCAATGTGACCATTGAAAGCTATAATATGAACCCGATTGTGTATTGGGAATATCAGATTATGCCGCAGGTTCCGGTGTTCACCGTGGAAGTGAAAAATTATGGTGTGAAAAATAGCGAATGGATTGATGCATGCATTAATATTAGCCATCATTATTGTAACATCAGCGATCATGTTGGCGATCCGAGCAATAGCCTGTGGGTGCGTGTGAAAGCCCGCGTTGGCCAGAAAGAAAGCGCATACGCTAAAAGCGAAGAATTCGCAGTGTGTCGCGATGGCAAAATTGGCCCGCCGAAACTGGATATTCGCAAAGAAGAAAAACAGATTATGATCGATATCTTCCATCCGAGTGTGTTCGTGAATGGTGATGAACAGGAAGTTGATTATGATCCGGAAACCACCTGTTATATTCGCGTGTATAATGTGTATGTTCGCATGAATGGTAGCGAAATTCAGTATAAAATCCTGACCCAGAAAGAAGATGATTGTGATGAAATTCAGTGTCAGCTGGCAATTCCGGTGAGTAGTCTGAATAGTCAGTATTGTGTGAGCGCAGAAGGCGTTCTGCATGTGTGGGGTGTGACCACCGAAAAAAGTAAAGAAGTGTGTATTACCATCTTCAATAGTAGCATTAAGGGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human IFIT3 ELISA Kit
E020387 1 Each

Human IFIT3 ELISA Kit

Sign In for Pricing
View Details
Mrm2 (NM_001107125) Rat Tagged ORF Clone Lentiviral Particle
RR202959L4V 200 µL

Mrm2 (NM_001107125) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Mouse Monoclonal Calpain small subunit 1 Antibody (1D11) [DyLight 650]
NBP2-59446C 0.1 mL

Mouse Monoclonal Calpain small subunit 1 Antibody (1D11) [DyLight 650]

Sign In for Pricing
View Details
Envafolimab Biosimilar - Research Grade
ICH5177-500mg 500 mg

Envafolimab Biosimilar - Research Grade

Sign In for Pricing
View Details
Recombinant Human TAR DNA-binding protein 43 (TARDBP), partial
CSB-EP023129HUe0-01 20 µg

Recombinant Human TAR DNA-binding protein 43 (TARDBP), partial

Sign In for Pricing
View Details
Recombinant Human TAR DNA-binding protein 43 (TARDBP), partial
CSB-EP023129HUe0-02 100 µg

Recombinant Human TAR DNA-binding protein 43 (TARDBP), partial

Sign In for Pricing
View Details