Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD116/CSF2RA Recombinant Protein

Product Specifications

Background

Granulocyte-macrophage colony-stimulating factor receptor subunit alpha (GM-CSF Receptor α), also known as CSF2RA and CD116, is a type 1 transmembrane protein with low affinity for GM-CSF. GM-CSF Receptor α is primarily expressed on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. GM-CSF Receptor α forms a heterodimeric receptor complex with GM-CSF Receptor β, creating the high affinity GM-CSF receptor. Upon dimerization and ligand binding, the β subunit becomes phosphorylated and transduces signals via Jak/STAT and MAPK pathways for cell proliferation, differentiation, and survival. Oligomerization of the high affinity GM-CSF Receptor α/β complex is required for optimal intracellular signal transduction. Soluble GM-CSF Receptor α, either secreted or cleaved from the cell surface, can competitively bind GM-CSF, preventing membrane receptor signaling. Multiple isoforms of GM-CSF Receptor α have been described.

CAS Number

9000-83-3

Swiss Prot

P15509

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~33kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAAAGAGCGATCTGCGTACCGTGGCACCGGCAAGCAGCCTGAATGTTCGCTTCGATAGCCGCACCATGAATCTGAGCTGGGATTGCCAGGAAAATACCACCTTCAGTAAATGCTTCCTGACCGATAAAAAAAATCGTGTTGTGGAACCGCGCCTGAGTAATAATGAATGTAGCTGCACCTTCCGTGAAATCTGTCTGCATGAAGGCGTTACCTTCGAAGTGCATGTGAATACCAGCCAGCGTGGCTTCCAGCAGAAACTGCTGTATCCGAATAGTGGCCGTGAAGGTACCGCCGCACAGAACTTCAGTTGCTTCATCTATAATGCAGATCTGATGAATTGTACCTGGGCACGTGGTCCGACCGCACCGCGTGATGTGCAGTACTTCCTGTATATTCGCAATAGTAAACGCCGCCGCGAAATTCGCTGTCCGTATTATATTCAGGATAGTGGTACCCATGTGGGCTGTCATCTGGATAATCTGAGTGGTCTGACCAGTCGCAATTACTTCCTGGTTAATGGTACCAGTCGTGAAATTGGTATTCAGTTCTTCGATAGCCTGCTGGATACCAAAAAAATTGAACGCTTCAATCCGCCGAGTAATGTTACCGTGCGCTGCAATACCACCCATTGCCTGGTTCGTTGGAAACAGCCGCGCACCTATCAGAAACTGAGCTATCTGGACTTCCAGTATCAGCTGGATGTGCATCGTAAAAATACCCAGCCGGGTACCGAAAATCTGCTGATTAATGTTAGCGGTGATCTGGAAAATCGTTATAACTTCCCGAGTAGCGAACCGCGTGCAAAACATAGCGTGAAAATTCGTGCCGCAGATGTGCGTATTCTGAATTGGAGCAGTTGGAGTGAAGCAATTGAATTCGGTAGTGATGATGGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-Human N4BP1 Polyclonal Antibody
HF659014-01 50 µg

Anti-Human N4BP1 Polyclonal Antibody

Sign In for Pricing
View Details
Anti-Human N4BP1 Polyclonal Antibody
HF659014-02 100 µg

Anti-Human N4BP1 Polyclonal Antibody

Sign In for Pricing
View Details
CD36 Polyclonal Antibody, APC Conjugated
bs-1100R-APC-01 20 µL

CD36 Polyclonal Antibody, APC Conjugated

Sign In for Pricing
View Details
CD36 Polyclonal Antibody, APC Conjugated
bs-1100R-APC-02 100 µL

CD36 Polyclonal Antibody, APC Conjugated

Sign In for Pricing
View Details
IL12RB2 siRNA (Human)
MBS8238036-01 15 nmol

IL12RB2 siRNA (Human)

Sign In for Pricing
View Details
IL12RB2 siRNA (Human)
MBS8238036-02 30 nmol

IL12RB2 siRNA (Human)

Sign In for Pricing
View Details