Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD116/CSF2RA Recombinant Protein

Product Specifications

Background

Granulocyte-macrophage colony-stimulating factor receptor subunit alpha (GM-CSF Receptor α), also known as CSF2RA and CD116, is a type 1 transmembrane protein with low affinity for GM-CSF. GM-CSF Receptor α is primarily expressed on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. GM-CSF Receptor α forms a heterodimeric receptor complex with GM-CSF Receptor β, creating the high affinity GM-CSF receptor. Upon dimerization and ligand binding, the β subunit becomes phosphorylated and transduces signals via Jak/STAT and MAPK pathways for cell proliferation, differentiation, and survival. Oligomerization of the high affinity GM-CSF Receptor α/β complex is required for optimal intracellular signal transduction. Soluble GM-CSF Receptor α, either secreted or cleaved from the cell surface, can competitively bind GM-CSF, preventing membrane receptor signaling. Multiple isoforms of GM-CSF Receptor α have been described.

CAS Number

9000-83-3

Swiss Prot

P15509

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~33kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAAAGAGCGATCTGCGTACCGTGGCACCGGCAAGCAGCCTGAATGTTCGCTTCGATAGCCGCACCATGAATCTGAGCTGGGATTGCCAGGAAAATACCACCTTCAGTAAATGCTTCCTGACCGATAAAAAAAATCGTGTTGTGGAACCGCGCCTGAGTAATAATGAATGTAGCTGCACCTTCCGTGAAATCTGTCTGCATGAAGGCGTTACCTTCGAAGTGCATGTGAATACCAGCCAGCGTGGCTTCCAGCAGAAACTGCTGTATCCGAATAGTGGCCGTGAAGGTACCGCCGCACAGAACTTCAGTTGCTTCATCTATAATGCAGATCTGATGAATTGTACCTGGGCACGTGGTCCGACCGCACCGCGTGATGTGCAGTACTTCCTGTATATTCGCAATAGTAAACGCCGCCGCGAAATTCGCTGTCCGTATTATATTCAGGATAGTGGTACCCATGTGGGCTGTCATCTGGATAATCTGAGTGGTCTGACCAGTCGCAATTACTTCCTGGTTAATGGTACCAGTCGTGAAATTGGTATTCAGTTCTTCGATAGCCTGCTGGATACCAAAAAAATTGAACGCTTCAATCCGCCGAGTAATGTTACCGTGCGCTGCAATACCACCCATTGCCTGGTTCGTTGGAAACAGCCGCGCACCTATCAGAAACTGAGCTATCTGGACTTCCAGTATCAGCTGGATGTGCATCGTAAAAATACCCAGCCGGGTACCGAAAATCTGCTGATTAATGTTAGCGGTGATCTGGAAAATCGTTATAACTTCCCGAGTAGCGAACCGCGTGCAAAACATAGCGTGAAAATTCGTGCCGCAGATGTGCGTATTCTGAATTGGAGCAGTTGGAGTGAAGCAATTGAATTCGGTAGTGATGATGGC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CNIH2 Rabbit Polyclonal Antibody (FITC)
orb2088471 100 µL

CNIH2 Rabbit Polyclonal Antibody (FITC)

Sign In for Pricing
View Details
Mouse Polr2i (NM_027259) AAV Particle
MR200650A1V 250 µL

Mouse Polr2i (NM_027259) AAV Particle

Sign In for Pricing
View Details
FAM198B CRISPR Activation Plasmid (m2)
sc-427131-ACT-2 20 µg

FAM198B CRISPR Activation Plasmid (m2)

Sign In for Pricing
View Details
SLC29A1 Protein Vector (Rat) (pPB-N-His)
PV305779 500 ng

SLC29A1 Protein Vector (Rat) (pPB-N-His)

Sign In for Pricing
View Details
Benzylamine, m-chloro-N- (2-chloroethyl) -N-ethyl-, hydrochloride
T30422-01 25 mg

Benzylamine, m-chloro-N- (2-chloroethyl) -N-ethyl-, hydrochloride

Sign In for Pricing
View Details
Benzylamine, m-chloro-N- (2-chloroethyl) -N-ethyl-, hydrochloride
T30422-02 50 mg

Benzylamine, m-chloro-N- (2-chloroethyl) -N-ethyl-, hydrochloride

Sign In for Pricing
View Details