CD113/NECTIN3 Recombinant Protein
Product Specifications
Background
Nectin is a Ca2+-independent homophilic cell adhesion molecule that belongs to the immunoglobulin superfamily. Human Nectin is identical to the poliovirus receptor-related protein (PRR) and is identified to be the alphaherpesvirus entry mediator. Nectin constitutes a family consisting of at least Nectin 1, 2 and 3. Nectin 2 and 3 are ubiquitously expressed, whereas Nectin 1 is abundantly expressed in brain. Nectin 3, also designated as PRR3, has three splicing variants: Nectin 3α, 3β and 3γ. Nectin 3 is a transmembrane protein whose extracellular region contains three Ig-like domains. Nectin 3α and 3β, but not Nectin 3γ, have a C-terminal conserved motif (E/A-X-Y-V) . This motif interacts with the PDZ domain of the F-Actin-binding protein, afadin, through which it is linked to the Actin cytoskeleton. Nectin 3α co-localizes with Nectin 2 at cadherin-based adheren junctions and interacts with afadin.
CAS Number
9000-83-3
Swiss Prot
Q9NQS3
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~38kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GGTCCTATTATTGTTGAACCGCATGTTACCGCCGTGTGGGGTAAAAATGTTAGTCTGAAATGCCTGATTGAAGTGAATGAAACCATTACCCAGATTAGTTGGGAAAAAATTCATGGCAAAAGTAGCCAGACCGTTGCCGTTCATCATCCGCAGTATGGCTTCAGTGTTCAGGGTGAATATCAGGGTCGTGTGCTGTTCAAAAATTATAGCCTGAATGATGCAACCATTACCCTGCATAATATTGGCTTCAGCGATAGTGGCAAATATATCTGTAAAGCCGTTACCTTCCCGCTGGGTAATGCACAGAGCAGCACCACCGTGACCGTTCTGGTTGAACCGACCGTTAGCCTGATTAAAGGCCCGGATAGTCTGATTGATGGTGGCAATGAAACCGTTGCAGCCATCTGTATTGCCGCCACCGGTAAACCGGTTGCACATATTGATTGGGAAGGCGATCTGGGCGAAATGGAAAGCACCACCACCAGCTTCCCGAATGAAACCGCAACCATTATTAGCCAGTATAAACTGTTCCCGACCCGCTTCGCACGTGGTCGTCGTATTACCTGTGTTGTTAAACATCCGGCCCTGGAAAAAGATATTCGTTATAGCTTCATTCTGGATATTCAGTATGCCCCGGAAGTTAGTGTTACCGGCTATGATGGTAATTGGTTCGTGGGTCGTAAAGGTGTTAATCTGAAATGCAATGCAGATGCCAATCCGCCGCCGTTCAAAAGCGTGTGGAGTCGTCTGGATGGCCAGTGGCCGGATGGTCTGCTGGCCAGCGATAATACCCTGCACTTCGTTCATCCGCTGACCTTCAATTATAGTGGCGTGTATATCTGTAAGGTGACCAATAGTCTGGGCCAGCGTAGCGATCAGAAAGTTATCTATATTAGTGATCCGCCGACCACCACCACCCTGCAGCCGACAATTCAGTGGCATCCGAGTACCGCAGATATTGAAGATCTGGCAACCGAACCGAAAAAACTGCCGTTCCCGCTGAGCACCCTGGCCACCATTAAAGATGATACCATTGCAACC
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog