Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD113/NECTIN3 Recombinant Protein

Product Specifications

Background

Nectin is a Ca2+-independent homophilic cell adhesion molecule that belongs to the immunoglobulin superfamily. Human Nectin is identical to the poliovirus receptor-related protein (PRR) and is identified to be the alphaherpesvirus entry mediator. Nectin constitutes a family consisting of at least Nectin 1, 2 and 3. Nectin 2 and 3 are ubiquitously expressed, whereas Nectin 1 is abundantly expressed in brain. Nectin 3, also designated as PRR3, has three splicing variants: Nectin 3α, 3β and 3γ. Nectin 3 is a transmembrane protein whose extracellular region contains three Ig-like domains. Nectin 3α and 3β, but not Nectin 3γ, have a C-terminal conserved motif (E/A-X-Y-V) . This motif interacts with the PDZ domain of the F-Actin-binding protein, afadin, through which it is linked to the Actin cytoskeleton. Nectin 3α co-localizes with Nectin 2 at cadherin-based adheren junctions and interacts with afadin.

CAS Number

9000-83-3

Swiss Prot

Q9NQS3

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~38kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTCCTATTATTGTTGAACCGCATGTTACCGCCGTGTGGGGTAAAAATGTTAGTCTGAAATGCCTGATTGAAGTGAATGAAACCATTACCCAGATTAGTTGGGAAAAAATTCATGGCAAAAGTAGCCAGACCGTTGCCGTTCATCATCCGCAGTATGGCTTCAGTGTTCAGGGTGAATATCAGGGTCGTGTGCTGTTCAAAAATTATAGCCTGAATGATGCAACCATTACCCTGCATAATATTGGCTTCAGCGATAGTGGCAAATATATCTGTAAAGCCGTTACCTTCCCGCTGGGTAATGCACAGAGCAGCACCACCGTGACCGTTCTGGTTGAACCGACCGTTAGCCTGATTAAAGGCCCGGATAGTCTGATTGATGGTGGCAATGAAACCGTTGCAGCCATCTGTATTGCCGCCACCGGTAAACCGGTTGCACATATTGATTGGGAAGGCGATCTGGGCGAAATGGAAAGCACCACCACCAGCTTCCCGAATGAAACCGCAACCATTATTAGCCAGTATAAACTGTTCCCGACCCGCTTCGCACGTGGTCGTCGTATTACCTGTGTTGTTAAACATCCGGCCCTGGAAAAAGATATTCGTTATAGCTTCATTCTGGATATTCAGTATGCCCCGGAAGTTAGTGTTACCGGCTATGATGGTAATTGGTTCGTGGGTCGTAAAGGTGTTAATCTGAAATGCAATGCAGATGCCAATCCGCCGCCGTTCAAAAGCGTGTGGAGTCGTCTGGATGGCCAGTGGCCGGATGGTCTGCTGGCCAGCGATAATACCCTGCACTTCGTTCATCCGCTGACCTTCAATTATAGTGGCGTGTATATCTGTAAGGTGACCAATAGTCTGGGCCAGCGTAGCGATCAGAAAGTTATCTATATTAGTGATCCGCCGACCACCACCACCCTGCAGCCGACAATTCAGTGGCATCCGAGTACCGCAGATATTGAAGATCTGGCAACCGAACCGAAAAAACTGCCGTTCCCGCTGAGCACCCTGGCCACCATTAAAGATGATACCATTGCAACC

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CA15-3 Cancer Antigen (CA15-3, Breast Tumor Protein)
C0050-27 10 KU

CA15-3 Cancer Antigen (CA15-3, Breast Tumor Protein)

Sign In for Pricing
View Details
SARS-CoV-2 (2019-nCoV) Spike protein peptide 4
MBS156042-01 0.05 mg

SARS-CoV-2 (2019-nCoV) Spike protein peptide 4

Sign In for Pricing
View Details
SARS-CoV-2 (2019-nCoV) Spike protein peptide 4
MBS156042-02 0.1 mg

SARS-CoV-2 (2019-nCoV) Spike protein peptide 4

Sign In for Pricing
View Details
SARS-CoV-2 (2019-nCoV) Spike protein peptide 4
MBS156042-03 1 mg

SARS-CoV-2 (2019-nCoV) Spike protein peptide 4

Sign In for Pricing
View Details
SARS-CoV-2 (2019-nCoV) Spike protein peptide 4
MBS156042-04 5x 1 mg

SARS-CoV-2 (2019-nCoV) Spike protein peptide 4

Sign In for Pricing
View Details
Prostate Specific Antigen, Free (Free PSA) (PE)
P9054-63-PE 100 µL

Prostate Specific Antigen, Free (Free PSA) (PE)

Sign In for Pricing
View Details