Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD112/NECTIN2 Recombinant Protein

Product Specifications

Background

Nectin-2, also known as CD112 and poliovirus receptor-related 2 (PVRL2), is a single-pass type I membrane glycoprotein ubiquitously expressed on various human tissues. It is a calcium independent cell adhesion molecule known to interact with several cell surface receptors, including DNAM-1 (CD226), LFA-1 (CD11a), Nectin-3 (CD113), TIGIT (VSTM3), and PVRIG (CD112R) . It is one of the major constituents of adherens junctions, and therefore plays a central role in a number of cellular processes, including adhesion, migration, and proliferation. Within the immune system, Nectin-2 modulates immune cell signaling. Upon interaction with DNAM-1 expressed on T and NK cells, Nectin-2 stimulates proliferation and cytokine production. Upon interaction with PVRIG, Nectin-2 inhibits proliferation. Thus, Nectin-2 can be either a co-stimulator or a co-inhibitor of immune cell function depending on competitive receptor interactions. Nectin-2 also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

CAS Number

9000-83-3

Swiss Prot

Q92692

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~44kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGATGTTCGCGTGCAGGTGCTGCCGGAAGTGCGCGGTCAGCTGGGTGGCACCGTGGAACTGCCGTGCCATCTGCTGCCGCCGGTGCCTGGTCTGTATATTAGTCTGGTTACCTGGCAGCGTCCGGATGCACCGGCAAATCATCAGAATGTTGCCGCCTTCCATCCGAAAATGGGCCCGAGCTTCCCGAGTCCGAAACCGGGCAGTGAACGTCTGAGCTTCGTTAGTGCAAAACAGAGCACCGGCCAGGATACCGAAGCCGAACTGCAGGATGCCACCCTGGCACTGCATGGTCTGACCGTGGAAGATGAAGGCAATTATACCTGTGAATTCGCAACCTTCCCGAAAGGTAGTGTTCGTGGTATGACCTGGCTGCGCGTGATTGCAAAACCGAAAAATCAGGCAGAAGCACAGAAAGTGACCTTCAGTCAGGATCCGACCACCGTGGCACTGTGCATTAGTAAAGAAGGTCGTCCGCCGGCACGCATTAGTTGGCTGAGCAGCCTGGATTGGGAAGCCAAAGAAACACAAGTGAGCGGTACCCTGGCCGGTACCGTTACCGTGACCAGTCGCTTCACCCTGGTGCCGAGCGGCCGCGCAGATGGTGTGACCGTTACCTGTAAAGTTGAACATGAAAGCTTCGAAGAACCGGCACTGATTCCGGTTACCCTGAGTGTTCGTTATCCGCCGGAAGTTAGTATTAGTGGCTATGATGATAATTGGTATCTGGGCCGCACCGATGCCACCTTAAGTTGTGATGTGCGCAGTAATCCGGAACCGACCGGTTATGATTGGAGCACCACCAGTGGCACCTTCCCGACCAGCGCCGTTGCCCAGGGCAGCCAACTGGTGATTCATGCCGTGGATAGTCTGTTCAATACCACCTTCGTGTGCACCGTGACCAATGCAGTTGGTATGGGTCGTGCAGAACAGGTGATCTTCGTTCGCGAAACACCTAATACCGCAGGTGCCGGTGCCACCGGTGGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Equine Interleukin-2 Cys141Ser
P1396-.1 100 µg

Recombinant Equine Interleukin-2 Cys141Ser

Sign In for Pricing
View Details
Albumin, Human Serum (HSA) (Biotin)
218781 500 µg

Albumin, Human Serum (HSA) (Biotin)

Sign In for Pricing
View Details
Recombinant Burkholderia mallei Chorismate synthase (aroC)
MBS1040415-01 0.02 mg (E-Coli)

Recombinant Burkholderia mallei Chorismate synthase (aroC)

Sign In for Pricing
View Details
Recombinant Burkholderia mallei Chorismate synthase (aroC)
MBS1040415-02 0.02 mg (Yeast)

Recombinant Burkholderia mallei Chorismate synthase (aroC)

Sign In for Pricing
View Details
Recombinant Burkholderia mallei Chorismate synthase (aroC)
MBS1040415-03 0.1 mg (E-Coli)

Recombinant Burkholderia mallei Chorismate synthase (aroC)

Sign In for Pricing
View Details
Recombinant Burkholderia mallei Chorismate synthase (aroC)
MBS1040415-04 0.1 mg (Yeast)

Recombinant Burkholderia mallei Chorismate synthase (aroC)

Sign In for Pricing
View Details