CD112/NECTIN2 Recombinant Protein
Product Specifications
Background
Nectin-2, also known as CD112 and poliovirus receptor-related 2 (PVRL2), is a single-pass type I membrane glycoprotein ubiquitously expressed on various human tissues. It is a calcium independent cell adhesion molecule known to interact with several cell surface receptors, including DNAM-1 (CD226), LFA-1 (CD11a), Nectin-3 (CD113), TIGIT (VSTM3), and PVRIG (CD112R) . It is one of the major constituents of adherens junctions, and therefore plays a central role in a number of cellular processes, including adhesion, migration, and proliferation. Within the immune system, Nectin-2 modulates immune cell signaling. Upon interaction with DNAM-1 expressed on T and NK cells, Nectin-2 stimulates proliferation and cytokine production. Upon interaction with PVRIG, Nectin-2 inhibits proliferation. Thus, Nectin-2 can be either a co-stimulator or a co-inhibitor of immune cell function depending on competitive receptor interactions. Nectin-2 also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
CAS Number
9000-83-3
Swiss Prot
Q92692
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~44kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CAGGATGTTCGCGTGCAGGTGCTGCCGGAAGTGCGCGGTCAGCTGGGTGGCACCGTGGAACTGCCGTGCCATCTGCTGCCGCCGGTGCCTGGTCTGTATATTAGTCTGGTTACCTGGCAGCGTCCGGATGCACCGGCAAATCATCAGAATGTTGCCGCCTTCCATCCGAAAATGGGCCCGAGCTTCCCGAGTCCGAAACCGGGCAGTGAACGTCTGAGCTTCGTTAGTGCAAAACAGAGCACCGGCCAGGATACCGAAGCCGAACTGCAGGATGCCACCCTGGCACTGCATGGTCTGACCGTGGAAGATGAAGGCAATTATACCTGTGAATTCGCAACCTTCCCGAAAGGTAGTGTTCGTGGTATGACCTGGCTGCGCGTGATTGCAAAACCGAAAAATCAGGCAGAAGCACAGAAAGTGACCTTCAGTCAGGATCCGACCACCGTGGCACTGTGCATTAGTAAAGAAGGTCGTCCGCCGGCACGCATTAGTTGGCTGAGCAGCCTGGATTGGGAAGCCAAAGAAACACAAGTGAGCGGTACCCTGGCCGGTACCGTTACCGTGACCAGTCGCTTCACCCTGGTGCCGAGCGGCCGCGCAGATGGTGTGACCGTTACCTGTAAAGTTGAACATGAAAGCTTCGAAGAACCGGCACTGATTCCGGTTACCCTGAGTGTTCGTTATCCGCCGGAAGTTAGTATTAGTGGCTATGATGATAATTGGTATCTGGGCCGCACCGATGCCACCTTAAGTTGTGATGTGCGCAGTAATCCGGAACCGACCGGTTATGATTGGAGCACCACCAGTGGCACCTTCCCGACCAGCGCCGTTGCCCAGGGCAGCCAACTGGTGATTCATGCCGTGGATAGTCTGTTCAATACCACCTTCGTGTGCACCGTGACCAATGCAGTTGGTATGGGTCGTGCAGAACAGGTGATCTTCGTTCGCGAAACACCTAATACCGCAGGTGCCGGTGCCACCGGTGGT
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog