Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

Integrin α5 (CD49e) Recombinant Protein

Product Specifications

Background

Integrins are α/β heterodimeric cell surface receptors that play a pivotal role in cell adhesion and migration, as well as in growth and survival. The integrin family contains at least 18 α and 8 β subunits that form 24 known integrins with distinct tissue distribution and overlapping ligand specificities. Integrins not only transmit signals to cells in response to the extracellular environment (outside-in signaling), but also sense intracellular cues to alter their interaction with the extracellular environment (inside-out signaling) . Integrin α5/β1 is involved in multiple biological processes including embryonic development, angiogenesis and tumor metastasis. By interaction with its fibronectin ligand, α5/β1 transduces signals that regulate cell adhesion, migration, matrix assembly and cytoskeletal organization.

CAS Number

9000-83-3

Swiss Prot

P08648

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~16kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CCTATTAACCCGAAAGGCCTGGAACTGGATCCGGAAGGTAGTCTGCATCATCAGCAGAAACGTGAAGCACCGAGTCGCAGTAGTGCCAGTAGCGGCCCGCAGATTCTGAAATGCCCGGAAGCCGAATGCTTCCGCCTGCGCTGTGAACTGGGCCCGCTGCATCAGCAGGAAAGCCAGAGCCTGCAGCTGCACTTCCGTGTGTGGGCAAAAACCTTCCTGCAGCGTGAACATCAGCCGTTCAGCCTGCAGTGCGAAGCAGTGTATAAAGCACTGAAAATGCCGTATCGTATTCTGCCGCGCCAGCTGCCGCAGAAAGAACGCCAGGTTGCAACCGCAGTGCAGTGGACCAAAGCAGAAGGCAGCTAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody
orb214083-01 30 µL

IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody
orb214083-02 50 μL

IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody
orb214083-03 100 µL

IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody
orb214083-04 200 µL

IFNGR1 (Phospho-Y457) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
A230051G13Rik Protein Vector (Mouse) (pPM-C-HA)
PV150600 500 ng

A230051G13Rik Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
mu Crystallin Recombinant Protein Antigen
NBP2-55172PEP 100 µL

mu Crystallin Recombinant Protein Antigen

Sign In for Pricing
View Details