Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL7R/CD127 Recombinant Protein

Product Specifications

Background

Interleukin 7 (IL-7) was originally described as a factor capable of inducing in vitro proliferation of pre-B cells from marrow cultures. The IL-7 gene encodes a protein 177 amino acids in length. IL-7 exerts its biological function through the IL-7 receptor which is expressed on pre-B cells, thymocytes and bone marrow-derived macrophages. The IL-7 receptor is composed of an IL-7 receptor-specific chain and the IL-2 receptor γ chain common to the IL-2, IL-4, IL-7, IL-9 and IL-15 receptors. IL-7 stimulation leads to the activation of Janus tyrosine kinase family members JAK1 and JAK3. Other studies have shown that in T cells, the IL-7 receptor-specific chain associates with the Src kinases family Lck and Fyn. IL-7 induces phosphorylation of insulin receptor substrate-1 (IRS-1) and Insulin receptor substrate-2 (IRS-2), originally called 4PS.

CAS Number

9000-83-3

Swiss Prot

P16871

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~28kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAAAGCGGTTATGCCCAGAATGGTGATCTGGAAGATGCAGAACTGGATGATTATAGCTTCAGTTGTTATAGTCAGCTGGAAGTGAATGGCAGCCAGCATAGCCTGACCTGCGCATTCGAAGATCCGGATGTTAATATTACCAATCTGGAATTCGAAATCTGCGGCGCACTGGTTGAAGTGAAATGCCTGAACTTCCGCAAACTGCAGGAAATCTACTTCATTGAAACCAAAAAATTCCTGCTGATTGGTAAAAGCAATATCTGTGTTAAAGTGGGTGAAAAAAGCCTGACCTGTAAAAAAATTGATCTGACCACCATTGTGAAACCGGAAGCACCGTTCGATCTGAGTGTGGTGTATCGTGAAGGCGCAAATGACTTCGTGGTGACCTTCAATACCAGTCATCTGCAGAAAAAATATGTTAAAGTGCTGATGCATGACGTGGCATATCGCCAGGAAAAAGATGAAAATAAATGGACCCATGTTAACCTGAGTAGTACCAAACTGACCCTGCTGCAGCGTAAACTGCAGCCGGCAGCCATGTATGAAATTAAAGTTCGTAGCATTCCGGATCATTACTTCAAAGGCTTCTGGAGCGAATGGAGTCCGAGTTATTACTTCCGCACCCCGGAAATTAATAATAGTAGTGGTGAAATGGAC

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

ABT-263 (Navitoclax) 50mg
A10022-50 50 mg

ABT-263 (Navitoclax) 50mg

Ask
View Details
Rabbit Polyclonal HLCS Antibody [DyLight 550]
NBP2-99591R 0.1 mL

Rabbit Polyclonal HLCS Antibody [DyLight 550]

Ask
View Details
Rho GTPase-Activating Protein 18 (ARHGAP18) Antibody
abx033977-01 80 µL

Rho GTPase-Activating Protein 18 (ARHGAP18) Antibody

Ask
View Details
Rho GTPase-Activating Protein 18 (ARHGAP18) Antibody
abx033977-02 400 µL

Rho GTPase-Activating Protein 18 (ARHGAP18) Antibody

Ask
View Details
Chromogranin A (CGA, CHG A, Pancreastatin, Parathyroid Secretory Protein 1, Pituitary Secretory Protein I, Vasostatin) (MaxLight 750)
MBS6236330-01 0.1 mL

Chromogranin A (CGA, CHG A, Pancreastatin, Parathyroid Secretory Protein 1, Pituitary Secretory Protein I, Vasostatin) (MaxLight 750)

Ask
View Details
Chromogranin A (CGA, CHG A, Pancreastatin, Parathyroid Secretory Protein 1, Pituitary Secretory Protein I, Vasostatin) (MaxLight 750)
MBS6236330-02 5x 0.1 mL

Chromogranin A (CGA, CHG A, Pancreastatin, Parathyroid Secretory Protein 1, Pituitary Secretory Protein I, Vasostatin) (MaxLight 750)

Ask
View Details