IL7R/CD127 Recombinant Protein
Product Specifications
Background
Interleukin 7 (IL-7) was originally described as a factor capable of inducing in vitro proliferation of pre-B cells from marrow cultures. The IL-7 gene encodes a protein 177 amino acids in length. IL-7 exerts its biological function through the IL-7 receptor which is expressed on pre-B cells, thymocytes and bone marrow-derived macrophages. The IL-7 receptor is composed of an IL-7 receptor-specific chain and the IL-2 receptor γ chain common to the IL-2, IL-4, IL-7, IL-9 and IL-15 receptors. IL-7 stimulation leads to the activation of Janus tyrosine kinase family members JAK1 and JAK3. Other studies have shown that in T cells, the IL-7 receptor-specific chain associates with the Src kinases family Lck and Fyn. IL-7 induces phosphorylation of insulin receptor substrate-1 (IRS-1) and Insulin receptor substrate-2 (IRS-2), originally called 4PS.
CAS Number
9000-83-3
Swiss Prot
P16871
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~28kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAAAGCGGTTATGCCCAGAATGGTGATCTGGAAGATGCAGAACTGGATGATTATAGCTTCAGTTGTTATAGTCAGCTGGAAGTGAATGGCAGCCAGCATAGCCTGACCTGCGCATTCGAAGATCCGGATGTTAATATTACCAATCTGGAATTCGAAATCTGCGGCGCACTGGTTGAAGTGAAATGCCTGAACTTCCGCAAACTGCAGGAAATCTACTTCATTGAAACCAAAAAATTCCTGCTGATTGGTAAAAGCAATATCTGTGTTAAAGTGGGTGAAAAAAGCCTGACCTGTAAAAAAATTGATCTGACCACCATTGTGAAACCGGAAGCACCGTTCGATCTGAGTGTGGTGTATCGTGAAGGCGCAAATGACTTCGTGGTGACCTTCAATACCAGTCATCTGCAGAAAAAATATGTTAAAGTGCTGATGCATGACGTGGCATATCGCCAGGAAAAAGATGAAAATAAATGGACCCATGTTAACCTGAGTAGTACCAAACTGACCCTGCTGCAGCGTAAACTGCAGCCGGCAGCCATGTATGAAATTAAAGTTCGTAGCATTCCGGATCATTACTTCAAAGGCTTCTGGAGCGAATGGAGTCCGAGTTATTACTTCCGCACCCCGGAAATTAATAATAGTAGTGGTGAAATGGAC
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog