Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL-4R/CD124 Recombinant Protein

Product Specifications

Background

The IL-2 receptor is a multicomponent complex consisting of three subunits, α, β and γ, each of which is required for high affinity binding of IL-2. The α chain functions primarily in binding IL-2, whereas the β and γ chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain, high-affinity ligand-binding cytokine receptors. However, it is now well established that the IL-2Rγ chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Rα and IL-7Rα, respectively, while the common subunit is referred to as γc. Although the common γ chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own. There is evidence that the γc chain is also a subunit of IL-13R.

CAS Number

9000-83-3

Swiss Prot

P24394

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AAGGTGCTGCAGGAACCGACCTGCGTTAGTGATTATATGAGCATTAGCACCTGTGAATGGAAAATGAATGGTCCGACCAATTGCAGTACCGAACTGCGCCTGCTGTATCAGCTGGTGTTCCTGCTGAGCGAAGCACATACCTGTATTCCGGAAAATAATGGCGGCGCCGGCTGTGTGTGTCATCTGCTGATGGATGATGTTGTGAGCGCCGATAATTATACCCTGGATCTGTGGGCAGGCCAGCAGCTGCTGTGGAAAGGTAGCTTCAAACCGAGTGAACATGTTAAACCGCGCGCCCCGGGCAATCTGACCGTTCATACCAATGTTAGCGATACCCTGCTGCTGACCTGGAGCAATCCGTATCCGCCGGATAATTATCTGTATAATCATCTGACCTACGCCGTTAATATCTGGAGCGAAAATGATCCGGCAGACTTCCGTATCTATAATGTTACCTATCTGGAACCGAGCCTGCGTATTGCCGCAAGTACCCTGAAAAGTGGCATTAGTTATCGTGCCCGTGTGCGCGCCTGGGCCCAGTGCTATAATACCACCTGGAGCGAATGGAGCCCGAGTACCAAATGGCATAATAGCTATCGTGAACCGTTCGAACAGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Tissue Genomic DNA, Colon: right
CD563862 5 µg

Tissue Genomic DNA, Colon: right

Sign In for Pricing
View Details
Mouse Clu activation kit by CRISPRa
GA200764 1 Kit

Mouse Clu activation kit by CRISPRa

Sign In for Pricing
View Details
Insl6 (NM_013754) Mouse Tagged ORF Clone
MG201820 10 µg

Insl6 (NM_013754) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Recombinant TRIB3 Antibody
RC-15990-01 50 μL

Recombinant TRIB3 Antibody

Sign In for Pricing
View Details
Recombinant TRIB3 Antibody
RC-15990-02 100 µL

Recombinant TRIB3 Antibody

Sign In for Pricing
View Details
Recombinant TRIB3 Antibody
RC-15990-03 1 mL

Recombinant TRIB3 Antibody

Sign In for Pricing
View Details