Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL-4R/CD124 Recombinant Protein

Product Specifications

Background

The IL-2 receptor is a multicomponent complex consisting of three subunits, α, β and γ, each of which is required for high affinity binding of IL-2. The α chain functions primarily in binding IL-2, whereas the β and γ chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain, high-affinity ligand-binding cytokine receptors. However, it is now well established that the IL-2Rγ chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Rα and IL-7Rα, respectively, while the common subunit is referred to as γc. Although the common γ chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own. There is evidence that the γc chain is also a subunit of IL-13R.

CAS Number

9000-83-3

Swiss Prot

P24394

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AAGGTGCTGCAGGAACCGACCTGCGTTAGTGATTATATGAGCATTAGCACCTGTGAATGGAAAATGAATGGTCCGACCAATTGCAGTACCGAACTGCGCCTGCTGTATCAGCTGGTGTTCCTGCTGAGCGAAGCACATACCTGTATTCCGGAAAATAATGGCGGCGCCGGCTGTGTGTGTCATCTGCTGATGGATGATGTTGTGAGCGCCGATAATTATACCCTGGATCTGTGGGCAGGCCAGCAGCTGCTGTGGAAAGGTAGCTTCAAACCGAGTGAACATGTTAAACCGCGCGCCCCGGGCAATCTGACCGTTCATACCAATGTTAGCGATACCCTGCTGCTGACCTGGAGCAATCCGTATCCGCCGGATAATTATCTGTATAATCATCTGACCTACGCCGTTAATATCTGGAGCGAAAATGATCCGGCAGACTTCCGTATCTATAATGTTACCTATCTGGAACCGAGCCTGCGTATTGCCGCAAGTACCCTGAAAAGTGGCATTAGTTATCGTGCCCGTGTGCGCGCCTGGGCCCAGTGCTATAATACCACCTGGAGCGAATGGAGCCCGAGTACCAAATGGCATAATAGCTATCGTGAACCGTTCGAACAGCAT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ELMO1 Rabbit Polyclonal Antibody
TA369103 100 µL

ELMO1 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
CA5B (NM_007220) Human Recombinant Protein
TP720091 10 µg

CA5B (NM_007220) Human Recombinant Protein

Sign In for Pricing
View Details
TNFS15 / VEGI (Vascular Endothelial Growth Inhibitor) (rVEGI/1283), CF647 conjugate, 0.1mg/mL
BNC472059-500 1x 500 µL

TNFS15 / VEGI (Vascular Endothelial Growth Inhibitor) (rVEGI/1283), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Recombinant Mouse TNFR1/TNFRSF1A Protein (His Tag)
PKSM040648 100 µg

Recombinant Mouse TNFR1/TNFRSF1A Protein (His Tag)

Sign In for Pricing
View Details
Mouse Ptcra activation kit by CRISPRa
GA203444 1 Kit

Mouse Ptcra activation kit by CRISPRa

Sign In for Pricing
View Details
TRAF5 Rabbit Polyclonal Antibody
TA363720 100 µL

TRAF5 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details