Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL-1Ra/CD121a Recombinant Protein

Product Specifications

Background

Three structurally related ligands for IL-1Rs have been described. Theseinclude two agonists, IL-1α and IL-1β, and a specific receptor antagonist, IL-1Rα. Among the activities regulated by IL-1 are fever, acute phase responses, degradation of connective tissue and immunostimulatory activities. The IL-1Rα molecule also binds specifically to IL-1Rs, but fails to initiate intracellular responses. Two distinct IL-1Rs have been identified, each of which belongs to the Ig superfamily and is widely expressed in a broad range of cells and tissues. Although many cell types co-express type I and type II receptors, there is no evidence that these constitute subunits of a single complex. The type II receptor has a short 29 amino acid cytoplasmic domain that does not seem sufficient for signaling while in fact there is considerable evidence arguing that IL-1 signals exclusively through the type I IL-1R.

CAS Number

9000-83-3

Swiss Prot

P14778

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~40kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGGAAGCAGATAAATGCAAAGAACGTGAAGAAAAAATCATCCTGGTTAGTAGCGCCAATGAAATTGATGTGCGTCCGTGTCCGCTGAATCCGAATGAACATAAAGGTACCATTACCTGGTATAAAGATGATAGTAAAACACCTGTGAGCACCGAACAGGCCAGTCGTATTCATCAGCATAAAGAAAAACTGTGGTTCGTTCCGGCCAAAGTTGAAGATAGTGGCCATTATTATTGTGTGGTGCGCAATAGCAGTTATTGTCTGCGTATTAAAATCAGTGCAAAATTCGTTGAAAACGAACCGAATCTGTGCTATAATGCACAGGCAATCTTCAAACAGAAACTGCCGGTGGCCGGTGATGGTGGTCTGGTGTGCCCGTATATGGAATTCTTCAAAAATGAAAACAACGAGCTGCCGAAACTGCAGTGGTATAAAGACTGCAAACCGCTGCTGCTGGATAATATTCACTTCAGTGGTGTGAAAGATCGTCTGATTGTTATGAATGTGGCAGAAAAACATCGTGGTAATTATACCTGTCATGCAAGCTATACCTATCTGGGCAAACAGTATCCGATTACCCGCGTTATTGAATTCATTACCCTGGAAGAAAATAAGCCGACCCGTCCGGTGATTGTTAGTCCGGCCAATGAAACCATGGAAGTGGATCTGGGTAGTCAGATTCAGCTGATCTGTAATGTTACCGGCCAGCTGAGCGATATTGCATATTGGAAATGGAATGGTAGTGTTATTGATGAAGATGATCCGGTTCTGGGTGAAGATTATTATAGTGTGGAAAATCCGGCAAATAAACGCCGCAGTACCCTGATTACCGTTCTGAATATTAGCGAAATTGAAAGCCGCTTCTATAAACATCCGTTCACCTGCTTCGCAAAAAATACCCATGGTATTGATGCAGCATATATTCAGCTGATCTATCCGGTGACCAACTTCCAGAAA

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

TRIM45 Mouse Monoclonal Antibody [Clone ID: LBI2B11]
AMM13552V 100 µL

TRIM45 Mouse Monoclonal Antibody [Clone ID: LBI2B11]

Ask
View Details
Slc44a5 (NM_001081263) Mouse Untagged Clone
MC220927 10 µg

Slc44a5 (NM_001081263) Mouse Untagged Clone

Ask
View Details
Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit
MBS7212751-01 48 Well

Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit

Ask
View Details
Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit
MBS7212751-02 96 Well

Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit

Ask
View Details
Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit
MBS7212751-03 5x 96 Well

Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit

Ask
View Details
Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit
MBS7212751-04 10x 96 Well

Canine Ankyrin repeat and SAM domain-containing protein 4B (ANKS4B) ELISA Kit

Ask
View Details