Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL-1Ra/CD121a Recombinant Protein

Product Specifications

Background

Three structurally related ligands for IL-1Rs have been described. Theseinclude two agonists, IL-1α and IL-1β, and a specific receptor antagonist, IL-1Rα. Among the activities regulated by IL-1 are fever, acute phase responses, degradation of connective tissue and immunostimulatory activities. The IL-1Rα molecule also binds specifically to IL-1Rs, but fails to initiate intracellular responses. Two distinct IL-1Rs have been identified, each of which belongs to the Ig superfamily and is widely expressed in a broad range of cells and tissues. Although many cell types co-express type I and type II receptors, there is no evidence that these constitute subunits of a single complex. The type II receptor has a short 29 amino acid cytoplasmic domain that does not seem sufficient for signaling while in fact there is considerable evidence arguing that IL-1 signals exclusively through the type I IL-1R.

CAS Number

9000-83-3

Swiss Prot

P14778

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~40kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGGAAGCAGATAAATGCAAAGAACGTGAAGAAAAAATCATCCTGGTTAGTAGCGCCAATGAAATTGATGTGCGTCCGTGTCCGCTGAATCCGAATGAACATAAAGGTACCATTACCTGGTATAAAGATGATAGTAAAACACCTGTGAGCACCGAACAGGCCAGTCGTATTCATCAGCATAAAGAAAAACTGTGGTTCGTTCCGGCCAAAGTTGAAGATAGTGGCCATTATTATTGTGTGGTGCGCAATAGCAGTTATTGTCTGCGTATTAAAATCAGTGCAAAATTCGTTGAAAACGAACCGAATCTGTGCTATAATGCACAGGCAATCTTCAAACAGAAACTGCCGGTGGCCGGTGATGGTGGTCTGGTGTGCCCGTATATGGAATTCTTCAAAAATGAAAACAACGAGCTGCCGAAACTGCAGTGGTATAAAGACTGCAAACCGCTGCTGCTGGATAATATTCACTTCAGTGGTGTGAAAGATCGTCTGATTGTTATGAATGTGGCAGAAAAACATCGTGGTAATTATACCTGTCATGCAAGCTATACCTATCTGGGCAAACAGTATCCGATTACCCGCGTTATTGAATTCATTACCCTGGAAGAAAATAAGCCGACCCGTCCGGTGATTGTTAGTCCGGCCAATGAAACCATGGAAGTGGATCTGGGTAGTCAGATTCAGCTGATCTGTAATGTTACCGGCCAGCTGAGCGATATTGCATATTGGAAATGGAATGGTAGTGTTATTGATGAAGATGATCCGGTTCTGGGTGAAGATTATTATAGTGTGGAAAATCCGGCAAATAAACGCCGCAGTACCCTGATTACCGTTCTGAATATTAGCGAAATTGAAAGCCGCTTCTATAAACATCCGTTCACCTGCTTCGCAAAAAATACCCATGGTATTGATGCAGCATATATTCAGCTGATCTATCCGGTGACCAACTTCCAGAAA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-OSGIN2  (2C4)
YF-MA12210 100 ug

Anti-OSGIN2 (2C4)

Sign In for Pricing
View Details
GALNT12 Rabbit Polyclonal Antibody
E10G03070 100 µL

GALNT12 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Integrin α8 Double Nickase Plasmid (h2)
sc-402020-NIC-2 20 µg

Integrin α8 Double Nickase Plasmid (h2)

Sign In for Pricing
View Details
Wdr67 siRNA Oligos set (Mouse)
50359174 3x 5 nmol

Wdr67 siRNA Oligos set (Mouse)

Sign In for Pricing
View Details
UCP-2 (Uncoupling Protein 2 mitochondrial) Sheep ELISA Kit
I0499 96 Tests

UCP-2 (Uncoupling Protein 2 mitochondrial) Sheep ELISA Kit

Sign In for Pricing
View Details
Phospho-ERK1 (Thr202/Tyr204) + ERK2 (Thr183/Tyr185) Rabbit Polyclonal Antibody (Cy3)
orb983254 100 µL

Phospho-ERK1 (Thr202/Tyr204) + ERK2 (Thr183/Tyr185) Rabbit Polyclonal Antibody (Cy3)

Sign In for Pricing
View Details