Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

IL-1Ra/CD121a Recombinant Protein

Product Specifications

Background

Three structurally related ligands for IL-1Rs have been described. Theseinclude two agonists, IL-1α and IL-1β, and a specific receptor antagonist, IL-1Rα. Among the activities regulated by IL-1 are fever, acute phase responses, degradation of connective tissue and immunostimulatory activities. The IL-1Rα molecule also binds specifically to IL-1Rs, but fails to initiate intracellular responses. Two distinct IL-1Rs have been identified, each of which belongs to the Ig superfamily and is widely expressed in a broad range of cells and tissues. Although many cell types co-express type I and type II receptors, there is no evidence that these constitute subunits of a single complex. The type II receptor has a short 29 amino acid cytoplasmic domain that does not seem sufficient for signaling while in fact there is considerable evidence arguing that IL-1 signals exclusively through the type I IL-1R.

CAS Number

9000-83-3

Swiss Prot

P14778

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~40kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGGAAGCAGATAAATGCAAAGAACGTGAAGAAAAAATCATCCTGGTTAGTAGCGCCAATGAAATTGATGTGCGTCCGTGTCCGCTGAATCCGAATGAACATAAAGGTACCATTACCTGGTATAAAGATGATAGTAAAACACCTGTGAGCACCGAACAGGCCAGTCGTATTCATCAGCATAAAGAAAAACTGTGGTTCGTTCCGGCCAAAGTTGAAGATAGTGGCCATTATTATTGTGTGGTGCGCAATAGCAGTTATTGTCTGCGTATTAAAATCAGTGCAAAATTCGTTGAAAACGAACCGAATCTGTGCTATAATGCACAGGCAATCTTCAAACAGAAACTGCCGGTGGCCGGTGATGGTGGTCTGGTGTGCCCGTATATGGAATTCTTCAAAAATGAAAACAACGAGCTGCCGAAACTGCAGTGGTATAAAGACTGCAAACCGCTGCTGCTGGATAATATTCACTTCAGTGGTGTGAAAGATCGTCTGATTGTTATGAATGTGGCAGAAAAACATCGTGGTAATTATACCTGTCATGCAAGCTATACCTATCTGGGCAAACAGTATCCGATTACCCGCGTTATTGAATTCATTACCCTGGAAGAAAATAAGCCGACCCGTCCGGTGATTGTTAGTCCGGCCAATGAAACCATGGAAGTGGATCTGGGTAGTCAGATTCAGCTGATCTGTAATGTTACCGGCCAGCTGAGCGATATTGCATATTGGAAATGGAATGGTAGTGTTATTGATGAAGATGATCCGGTTCTGGGTGAAGATTATTATAGTGTGGAAAATCCGGCAAATAAACGCCGCAGTACCCTGATTACCGTTCTGAATATTAGCGAAATTGAAAGCCGCTTCTATAAACATCCGTTCACCTGCTTCGCAAAAAATACCCATGGTATTGATGCAGCATATATTCAGCTGATCTATCCGGTGACCAACTTCCAGAAA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Psmd2 (NM_134101) Mouse Recombinant Protein
TP511143 20 µg

Psmd2 (NM_134101) Mouse Recombinant Protein

Sign In for Pricing
View Details
Goat Melatonin Receptor 1A Antibody ELISA kit
GTR10444448 96 Well

Goat Melatonin Receptor 1A Antibody ELISA kit

Sign In for Pricing
View Details
Mouse Interleukin 3, IL-3 ELISA Kit
MBS160572-01 48 Well

Mouse Interleukin 3, IL-3 ELISA Kit

Sign In for Pricing
View Details
Mouse Interleukin 3, IL-3 ELISA Kit
MBS160572-02 96 Well

Mouse Interleukin 3, IL-3 ELISA Kit

Sign In for Pricing
View Details
Mouse Interleukin 3, IL-3 ELISA Kit
MBS160572-03 5x 96 Well

Mouse Interleukin 3, IL-3 ELISA Kit

Sign In for Pricing
View Details
Mouse Interleukin 3, IL-3 ELISA Kit
MBS160572-04 10x 96 Well

Mouse Interleukin 3, IL-3 ELISA Kit

Sign In for Pricing
View Details