What is the catalog number for CD97 Recombinant Protein?

The catalog number for CD97 Recombinant Protein is NCP0237.

What sizes are available for CD97 Recombinant Protein?

CD97 Recombinant Protein is available in the following size(s): 500 µg, 1 mg.

How many pack sizes does CD97 Recombinant Protein come in?

CD97 Recombinant Protein is available in 2 different pack sizes.

Is CD97 Recombinant Protein in stock?

CD97 Recombinant Protein is currently made to order / not held in immediate stock. Contact us for lead time.

Is this product animal-origin-free?

Animal-origin-free status, where applicable, is noted on the datasheet under formulation details.

Does this product need any special customs documentation to be imported to my country?

If you’re outside the EU, UK, or USA, you’re responsible for customs clearance and any related taxes or fees. We provide the standard import documents, such as the Commercial Invoice, Packing List, and Airway Bill, in advance, so let us know early if your customs office needs anything additional for this specific product.

What buffer is this product supplied in?

The formulation or storage buffer is listed on the product datasheet. If you require a carrier-free or custom formulation, contact us before ordering, as this may involve a made-to-order production timeline.

CD97 Recombinant Protein

Product Specifications

Background

CD97 is a member of the EGF-TM7 (seven-span transmembrane) protein family, which is characterized by an extended extracellular region with a variable number of N-terminal EGF-like domains coupled to a TM7 stalk. It is expressed by leukocytes following activation. CD97 binds to its cellular ligand CD55 (decay accelerating factor) and protects several cell types from complement-mediated damage. The CD97-CD55 interaction may play a role in cellular activation, migration and adhesion following inflammation. CD97 expression is increased in thyroid cancer, paralleling dedifferentiation and tumor staging in this disease. Many colorectal cell lines are also CD97+, with CD97 levels correlating with migration and invasion in vitro. CD97 is also expressed in various gastric, pancreatic and esophageal carcinomas. CD97 shares significant homology with EMR2, however the two proteins exhibit different expression patterns, as EMR2 is not expressed in any of the aforementioned cancer cells.

CAS Number

9000-83-3

Swiss Prot

P48960

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~64kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGATAGCCGCGGCTGCGCACGCTGGTGCCCTCAAAATAGTAGTTGCGTTAATGCAACCGCATGCCGTTGTAATCCGGGCTTCAGCAGCTTCAGCGAAATTATTACCACCCCGACCGAAACCTGTGATGATATTAATGAATGCGCAACCCCGAGTAAAGTGAGTTGCGGCAAATTCAGCGATTGCTGGAATACCGAAGGCAGCTATGATTGCGTGTGTAGCCCGGGCTATGAACCGGTGAGTGGCGCAAAAACCTTCAAAAATGAAAGCGAAAATACCTGTCAGGATGTGGATGAATGTCAGCAGAATCCGCGTCTGTGTAAAAGCTATGGCACCTGCGTTAATACCCTGGGTAGCTATACCTGCCAGTGCCTGCCGGGCTTCAAATTCATTCCGGAAGATCCGAAAGTGTGCACCGATGTTAATGAATGCACCAGTGGCCAGAATCCGTGTCATAGTAGTACCCATTGTCTGAATAATGTGGGCAGTTATCAGTGCCGTTGTCGCCCGGGCTGGCAGCCTATTCCGGGTAGTCCGAATGGTCCGAATAATACCGTGTGTGAAGATGTTGATGAATGCAGCAGTGGTCAGCATCAGTGCGATAGTAGCACCGTGTGCTTCAATACCGTGGGCAGTTACAGTTGTCGTTGCCGTCCGGGTTGGAAACCGCGTCATGGTATTCCGAATAATCAGAAAGATACCGTGTGTGAGGATATGACCTTCAGTACCTGGACCCCGCCGCCGGGTGTGCATAGCCAGACCCTGAGTCGCTTCTTCGATAAAGTGCAGGATCTGGGTCGTGATAGTAAAACCAGCAGTGCAGAAGTTACCATTCAGAATGTTATTAAACTGGTTGATGAGCTGATGGAAGCCCCGGGTGATGTTGAAGCACTGGCCCCGCCGGTGCGTCATCTGATTGCAACCCAGCTGCTGAGCAATCTGGAAGATATTATGCGCATTCTGGCCAAAAGCCTGCCGAAAGGCCCGTTCACCTATATTAGCCCGAGTAATACCGAACTGACCCTGATGATTCAGGAACGCGGTGATAAAAATGTTACCATGGGTCAGAGCAGTGCCCGCATGAAACTGAATTGGGCCGTTGCCGCCGGCGCAGAAGATCCGGGTCCGGCAGTGGCAGGCATTCTGAGTATTCAGAATATGACCACCCTGCTGGCCAATGCAAGTCTGAATCTGCATAGCAAAAAACAGGCCGAACTGGAAGAAATCTATGAAAGTAGTATTCGTGGTGTTCAGCTGCGTCGTCTGAGTGCCGTGAATAGCATCTTCCTGAGTCATAATAATACCAAAGAACTGAATAGCCCGATTCTGTTCGCATTCAGTCATCTGGAAAGCAGTGATGGCGAAGCAGGCCGTGATCCGCCGGCAAAAGATGTGATGCCGGGTCCGCGCCAGGAACTGCTGTGTGCCTTCTGGAAAAGTGATAGCGATCGTGGTGGCCATTGGGCCACCGAAGGTTGCCAGGTTCTGGGTAGTAAAAATGGTAGTACCACCTGCCAGTGTAGCCATCTGAGCAGCTTCGCAATTCTGATGGCCCATTATGATGTTGAAGATTGGAAACTGACCCTGATTACCCGT