Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD9 Recombinant Protein

Product Specifications

Background

The CD9 antigen belongs to the tetraspanin family of cell surface glycoproteins, and is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin-enriched microdomains (TEMs), where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. Research studies demonstrate that CD9 expression on the egg is required for gamete fusion during fertilization. CD9 was also shown to play a role in dendritic cell migration, megakaryocyte differentiation, and homing of cord blood CD34+ hematopoietic progenitors to the bone marrow. In addition, down regulation of CD9 expression is associated with poor prognosis and progression of several types of cancer. Additional research identified CD9 as an abundant component of exosomes, and may play some role in the fusion of these secreted membrane vesicles with recipient cells.

CAS Number

9000-83-3

Swiss Prot

P21926

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~9kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

AGTCATAAGGATGAAGTGATTAAGGAAGTGCAGGAATTCTATAAAGATACCTATAATAAGCTGAAGACCAAAGATGAACCGCAGCGTGAAACCTTAAAAGCAATTCATTATGCCCTGAATTGCTGTGGTCTGGCAGGTGGCGTGGAACAGTTCATTAGTGATATCTGTCCGAAAAAAGATGTTCTGGAAACCTTCACCGTTAAAAGCTGCCCGGATGCCATTAAAGAAGTGTTCGATAATAAATTCCACATC

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Clnk Pre-designed siRNA Set A
SI102733A 1 Each

Mouse Clnk Pre-designed siRNA Set A

Sign In for Pricing
View Details
Hydrazine L- (+) -Tartrate
AAA63462-01 10 g

Hydrazine L- (+) -Tartrate

Sign In for Pricing
View Details
Hydrazine L- (+) -Tartrate
AAA63462-02 25 g

Hydrazine L- (+) -Tartrate

Sign In for Pricing
View Details
Hydrazine L- (+) -Tartrate
AAA63462-03 50 g

Hydrazine L- (+) -Tartrate

Sign In for Pricing
View Details
Dapagliflozin
A5854-5.1 10 mM (in 1mL DMSO)

Dapagliflozin

Sign In for Pricing
View Details
DUSP4 ELISA Kit (Human)
OKEH02216-96W 96 Well

DUSP4 ELISA Kit (Human)

Sign In for Pricing
View Details