CD8B Recombinant Protein
Product Specifications
Background
The T cell receptor (TCR) is a heterodimer composed of either a and b or γ and δ chains. CD3 chains and the CD4 or CD8 co-receptors are also required for efficient signal transduction through the TCR. The TCR is expressed on T helper and T cytotoxic cells that can be distinguished by their expression of CD4 and CD8. T helper cells express CD4 proteins and T cytotoxic cells display CD8. CD8 (also designated Leu 2 or T8), a cell surface glycoprotein, is a two chain complex (aa or ab) receptor that binds class I MHC molecules presented by the antigen-presenting cell (APC) . A primary function of CD8 is to facilitate antigen recognition by the TCR and to strengthen the avidity of the TCR-antigen interactions. An additional role for CD8-expressing T cells may be to maintain low levels of HIV expression.
CAS Number
9000-83-3
Swiss Prot
P10966
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~18kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items