Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD8B Recombinant Protein

Product Specifications

Background

The T cell receptor (TCR) is a heterodimer composed of either a and b or γ and δ chains. CD3 chains and the CD4 or CD8 co-receptors are also required for efficient signal transduction through the TCR. The TCR is expressed on T helper and T cytotoxic cells that can be distinguished by their expression of CD4 and CD8. T helper cells express CD4 proteins and T cytotoxic cells display CD8. CD8 (also designated Leu 2 or T8), a cell surface glycoprotein, is a two chain complex (aa or ab) receptor that binds class I MHC molecules presented by the antigen-presenting cell (APC) . A primary function of CD8 is to facilitate antigen recognition by the TCR and to strengthen the avidity of the TCR-antigen interactions. An additional role for CD8-expressing T cells may be to maintain low levels of HIV expression.

CAS Number

9000-83-3

Swiss Prot

P10966

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~18kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGCAGCAGACCCCGGCTTATATTAAAGTTCAGACCAATAAAATGGTGATGCTGAGCTGCGAAGCAAAAATTAGTCTGAGCAATATGCGCATCTATTGGCTGCGCCAGCGCCAGGCACCGAGTAGTGATAGTCATCATGAATTCCTGGCCCTGTGGGATAGCGCCAAAGGTACCATTCATGGCGAAGAAGTGGAACAGGAAAAAATTGCCGTGTTCCGTGATGCCAGCCGCTTCATTCTGAATCTGACCAGCGTTAAACCGGAAGATAGTGGCATCTACTTCTGCATGATTGTTGGCAGTCCGGAACTGACCTTCGGCAAAGGTACCCAGCTGAGCGTTGTTGACTTCCTGCCGACCACCGCACAGCCGACCAAAAAAAGTACCCTGAAAAAACGTGTGTGCCGCCTGCCGCGCCCGGAAACACAGAAAGGTCCGCTGTGCAGTCCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Chromotropic acid disodium dihydrate
TYD-01433-01 10 g

Chromotropic acid disodium dihydrate

Sign In for Pricing
View Details
Chromotropic acid disodium dihydrate
TYD-01433-02 5 g

Chromotropic acid disodium dihydrate

Sign In for Pricing
View Details
Chromotropic acid disodium dihydrate
TYD-01433-03 50 g

Chromotropic acid disodium dihydrate

Sign In for Pricing
View Details
Anti-C1s Antibody (Sutimlimab)
F1359-1 1 mg

Anti-C1s Antibody (Sutimlimab)

Sign In for Pricing
View Details
5- (Methylsulfonyl) pentyl Nitrile
orb652025-01 5 mg

5- (Methylsulfonyl) pentyl Nitrile

Sign In for Pricing
View Details
5- (Methylsulfonyl) pentyl Nitrile
orb652025-02 25 mg

5- (Methylsulfonyl) pentyl Nitrile

Sign In for Pricing
View Details