Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD86 Recombinant Protein

Product Specifications

Background

CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regulate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregulated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimulatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which results in the downregulation of T cell activity.

CAS Number

9000-83-3

Swiss Prot

P42081

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTCCTCTGAAAATTCAGGCATACTTCAATGAAACCGCAGATCTGCCGTGTCAGTTCGCCAATAGTCAGAATCAGAGCCTGAGCGAACTGGTGGTGTTCTGGCAGGATCAGGAAAATCTGGTGCTGAATGAAGTGTATCTGGGTAAAGAAAAATTCGATAGTGTTCATAGTAAGTACATGGGCCGCACCAGCTTCGATAGTGATAGCTGGACCCTGCGTCTGCATAATCTGCAGATTAAAGATAAAGGTCTGTATCAGTGCATTATTCATCATAAAAAGCCGACCGGTATGATTCGCATTCATCAGATGAATAGTGAACTGAGTGTTCTGGCAAACTTCAGTCAGCCGGAAATTGTTCCGATTAGTAATATTACCGAAAACGTGTATATCAACCTGACCTGTAGCAGCATTCATGGTTATCCGGAACCGAAAAAAATGAGCGTTCTGCTGCGCACCAAAAATAGTACCATTGAATATGATGGCGTGATGCAGAAAAGTCAGGATAATGTTACCGAACTGTATGATGTGAGCATTAGCCTGAGCGTTAGCTTCCCGGATGTGACCAGTAATATGACCATCTTCTGCATTCTGGAAACCGATAAAACCAGACTGCTGAGTAGCCCGTTCAGTATTGAACTGGAAGATCCGCAGCCGCCGCCGGATCATATTCCG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

2-Deoxy-2-fluoro-D-glucose-13C6
HY-W768211 1 Each

2-Deoxy-2-fluoro-D-glucose-13C6

Sign In for Pricing
View Details
Gel Mix %4-20, 20 gels
NB00G042020 20 Gels

Gel Mix %4-20, 20 gels

Sign In for Pricing
View Details
Gelsolin (GS) BioAssayTM ECL Kit (Human)
366042 96 Tests

Gelsolin (GS) BioAssayTM ECL Kit (Human)

Sign In for Pricing
View Details
Parainfluenza Type 3 (Parainfluenza Virus Type 3)
367727 100 µg

Parainfluenza Type 3 (Parainfluenza Virus Type 3)

Sign In for Pricing
View Details
IARS2 (Isoleucyl-tRNA Synthetase 2 Mitochondrial, IleRS, FLJ10326, Isoleucine-tRNA Ligase) (FITC)
MBS6481352-01 0.2 mL

IARS2 (Isoleucyl-tRNA Synthetase 2 Mitochondrial, IleRS, FLJ10326, Isoleucine-tRNA Ligase) (FITC)

Sign In for Pricing
View Details
IARS2 (Isoleucyl-tRNA Synthetase 2 Mitochondrial, IleRS, FLJ10326, Isoleucine-tRNA Ligase) (FITC)
MBS6481352-02 5x 0.2 mL

IARS2 (Isoleucyl-tRNA Synthetase 2 Mitochondrial, IleRS, FLJ10326, Isoleucine-tRNA Ligase) (FITC)

Sign In for Pricing
View Details