Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD83 Recombinant Protein

Product Specifications

Background

CD83 is a single-transmembrane protein with a calculated molecular weight (MW) of 23 kDa, but due to heavy and differential glycosylation, its apparent MW ranges from 23 to 70 kDa. CD83 is predominantly expressed on mature dendritic cells (DCs) and has been used as a DC activation/maturation marker as its increased expression is correlated with upregulation of HLA class II antigen expression on DCs. CD83 is also expressed at a low level on lymphocytes and is upregulated upon lymphocyte activation. Thymic epithelial cells also express CD83, which is required for normal CD4+ T cell development. CD83 is also expressed as a soluble form (sCD83) that can be found in serum of healthy adults. sCD83 has been shown to negatively regulate immune response by lymphocytes.

CAS Number

9000-83-3

Swiss Prot

Q01151

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~19kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

ACCCCTGAAGTGAAAGTGGCATGTAGTGAAGATGTGGATCTGCCGTGTACCGCCCCGTGGGATCCGCAGGTGCCGTATACCGTGAGTTGGGTGAAACTGCTGGAAGGTGGTGAAGAACGCATGGAAACACCTCAGGAAGATCATCTGCGTGGCCAGCATTATCATCAGAAAGGTCAGAATGGTAGCTTCGATGCACCGAATGAACGTCCGTATAGTCTGAAAATTCGTAATACCACCAGTTGTAATAGCGGCACCTATCGTTGTACCCTGCAGGATCCGGATGGTCAGCGTAATCTGAGCGGTAAAGTTATTCTGCGCGTTACCGGCTGCCCGGCCCAGAGAAAAGAAGAAACCTTCAAAAAATACCGCGCAGAA

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

OAAV00330-200UG - LEY Antibody
OAAV00330-200UG 200µg

OAAV00330-200UG - LEY Antibody

Sign In for Pricing
View Details
Recombinant Streptococcus Pneumoniae rplU Protein (aa 1-104)
VAng-Cr7923-50gEcoli 50 µg (E. coli)

Recombinant Streptococcus Pneumoniae rplU Protein (aa 1-104)

Sign In for Pricing
View Details
Zaldaride maleate 25mg
A21796-25 25 mg

Zaldaride maleate 25mg

Sign In for Pricing
View Details
Tissue FFPE Sections, Ovary: right
CS704863 5x 5 µm

Tissue FFPE Sections, Ovary: right

Sign In for Pricing
View Details
APC/CY7-Linked Polyclonal Antibody to Activin A Receptor Type II A (ACVR2A)
MBS2063282-01 0.1 mL

APC/CY7-Linked Polyclonal Antibody to Activin A Receptor Type II A (ACVR2A)

Sign In for Pricing
View Details
APC/CY7-Linked Polyclonal Antibody to Activin A Receptor Type II A (ACVR2A)
MBS2063282-02 0.2 mL

APC/CY7-Linked Polyclonal Antibody to Activin A Receptor Type II A (ACVR2A)

Sign In for Pricing
View Details