Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD82 Recombinant Protein

Product Specifications

Background

CD82 (KAI1) belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . CD82 does not have enzymatic activity and appears to function by regulating the trafficking of other proteins and organization of the cell membrane. CD82 was originally described as a costimulator for T cells that directly associates with CD4 and CD8, and was subsequently identified during a screen as a metastasis suppressor in prostate cancer. CD82 has since been found to act as a metastasis suppressor in a variety of cancers, and its downregulation is associated with poor prognosis in research studies. CD82 suppresses metastasis through multiple mechanisms including inhibition of cell motility and invasion by modulating c-Met and the urokinase plasminogen activator surface receptor (uPAR), as well as promotion of homotypic cell-cell adhesion by stabilizing interactions between E-cadherin and β-catenin.

CAS Number

9000-83-3

Swiss Prot

P27701

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTAAACTGAAACAGGAAATGGGCGGTATTGTGACCGAACTGATTCGTGATTATAATAGTAGTCGCGAAGATAGCCTGCAGGATGCCTGGGATTATGTTCAGGCACAGGTGAAATGCTGCGGTTGGGTGAGCTTCTATAATTGGACCGATAATGCCGAACTGATGAATCGCCCGGAAGTGACCTATCCGTGTAGCTGTGAAGTTAAAGGCGAAGAAGATAATAGTCTGAGCGTGCGTAAAGGCTTCTGTGAAGCCCCGGGCAATCGCACCCAGAGTGGCAATCATCCGGAAGATTGGCCGGTGTATCAGGAAGGTTGTATGGAAAAAGTTCAGGCCTGGCTGCAGGAAAATCTG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate
OR1064124-01 100 mg

Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate

Sign In for Pricing
View Details
Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate
OR1064124-02 250 mg

Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate

Sign In for Pricing
View Details
Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate
OR1064124-03 1 g

Ethyl 2-bromo-4H-furo[3,2-b]pyrrole-5-carboxylate

Sign In for Pricing
View Details
PCAF, NT (KAT2B, PCAF, Histone acetyltransferase KAT2B, Histone acetyltransferase PCAF, Lysine acetyltransferase 2B, P300/CBP-associated factor) (MaxLight 490) discontinued
039716-ML490 100 µL

PCAF, NT (KAT2B, PCAF, Histone acetyltransferase KAT2B, Histone acetyltransferase PCAF, Lysine acetyltransferase 2B, P300/CBP-associated factor) (MaxLight 490) discontinued

Sign In for Pricing
View Details
KRT18P48 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1174908 1.0 µg DNA

KRT18P48 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing
View Details
Phospho-HSP90AB1 (Ser254) Antibody
A41440-100UL 100 µL

Phospho-HSP90AB1 (Ser254) Antibody

Sign In for Pricing
View Details