Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD82 Recombinant Protein

Product Specifications

Background

CD82 (KAI1) belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . CD82 does not have enzymatic activity and appears to function by regulating the trafficking of other proteins and organization of the cell membrane. CD82 was originally described as a costimulator for T cells that directly associates with CD4 and CD8, and was subsequently identified during a screen as a metastasis suppressor in prostate cancer. CD82 has since been found to act as a metastasis suppressor in a variety of cancers, and its downregulation is associated with poor prognosis in research studies. CD82 suppresses metastasis through multiple mechanisms including inhibition of cell motility and invasion by modulating c-Met and the urokinase plasminogen activator surface receptor (uPAR), as well as promotion of homotypic cell-cell adhesion by stabilizing interactions between E-cadherin and β-catenin.

CAS Number

9000-83-3

Swiss Prot

P27701

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GGTAAACTGAAACAGGAAATGGGCGGTATTGTGACCGAACTGATTCGTGATTATAATAGTAGTCGCGAAGATAGCCTGCAGGATGCCTGGGATTATGTTCAGGCACAGGTGAAATGCTGCGGTTGGGTGAGCTTCTATAATTGGACCGATAATGCCGAACTGATGAATCGCCCGGAAGTGACCTATCCGTGTAGCTGTGAAGTTAAAGGCGAAGAAGATAATAGTCTGAGCGTGCGTAAAGGCTTCTGTGAAGCCCCGGGCAATCGCACCCAGAGTGGCAATCATCCGGAAGATTGGCCGGTGTATCAGGAAGGTTGTATGGAAAAAGTTCAGGCCTGGCTGCAGGAAAATCTG

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

CD178 (Apoptosis Antigen Ligand, APT1LG1, APTL, CD95 Ligand, CD95L, CD95-L, FAS Antigen Ligand, Fas Ligand, FASL, FASLG, Tumor Necrosis Factor Ligand Superfamily Member 6, TNFSF6) (Biotin)
MBS6372852-01 0.1 mL

CD178 (Apoptosis Antigen Ligand, APT1LG1, APTL, CD95 Ligand, CD95L, CD95-L, FAS Antigen Ligand, Fas Ligand, FASL, FASLG, Tumor Necrosis Factor Ligand Superfamily Member 6, TNFSF6) (Biotin)

Ask
View Details
CD178 (Apoptosis Antigen Ligand, APT1LG1, APTL, CD95 Ligand, CD95L, CD95-L, FAS Antigen Ligand, Fas Ligand, FASL, FASLG, Tumor Necrosis Factor Ligand Superfamily Member 6, TNFSF6) (Biotin)
MBS6372852-02 5x 0.1 mL

CD178 (Apoptosis Antigen Ligand, APT1LG1, APTL, CD95 Ligand, CD95L, CD95-L, FAS Antigen Ligand, Fas Ligand, FASL, FASLG, Tumor Necrosis Factor Ligand Superfamily Member 6, TNFSF6) (Biotin)

Ask
View Details
Piribedil N-Oxide
019808 25 mg

Piribedil N-Oxide

Ask
View Details
Magic™ Membrane Protein Human CEACAM3 (CEA cell adhesion molecule 3) Full Length
MPC2477K Each

Magic™ Membrane Protein Human CEACAM3 (CEA cell adhesion molecule 3) Full Length

Ask
View Details
SKI (Avian Sarcoma Viral (v ski) Oncogene Homolog, C Oncogene, C ski, Proto-Oncogene c-Ski, SKI, Ski Oncogene, Ski oncoprotein, SKI_HUMAN, SKV, v ski avian Sarcoma Viral Oncogene Homolog, v ski Sarcoma Viral Oncogene Homolog, v-ski Sarcoma Viral Oncogene Homolog, ) discontinued
225825-01 50 µL

SKI (Avian Sarcoma Viral (v ski) Oncogene Homolog, C Oncogene, C ski, Proto-Oncogene c-Ski, SKI, Ski Oncogene, Ski oncoprotein, SKI_HUMAN, SKV, v ski avian Sarcoma Viral Oncogene Homolog, v ski Sarcoma Viral Oncogene Homolog, v-ski Sarcoma Viral Oncogene Homolog, ) discontinued

Ask
View Details
SKI (Avian Sarcoma Viral (v ski) Oncogene Homolog, C Oncogene, C ski, Proto-Oncogene c-Ski, SKI, Ski Oncogene, Ski oncoprotein, SKI_HUMAN, SKV, v ski avian Sarcoma Viral Oncogene Homolog, v ski Sarcoma Viral Oncogene Homolog, v-ski Sarcoma Viral Oncogene Homolog, ) discontinued
225825-02 100 µL

SKI (Avian Sarcoma Viral (v ski) Oncogene Homolog, C Oncogene, C ski, Proto-Oncogene c-Ski, SKI, Ski Oncogene, Ski oncoprotein, SKI_HUMAN, SKV, v ski avian Sarcoma Viral Oncogene Homolog, v ski Sarcoma Viral Oncogene Homolog, v-ski Sarcoma Viral Oncogene Homolog, ) discontinued

Ask
View Details