Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD81 Recombinant Protein

Product Specifications

Background

CD81 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction (3) . CD81, like other tetraspanins, is enriched in exosomes. Many research studies demonstrate a role for CD81 in lymphocyte signaling. CD81 is also a well-characterized receptor for Hepatitis C Virus and facilitates the entry of the virus into target cells.

CAS Number

9000-83-3

Swiss Prot

P60033

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~10kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

TTCGTTAACAAGGATCAGATTGCAAAAGATGTGAAACAGTTCTATGATCAGGCCCTGCAGCAGGCAGTGGTGGATGATGATGCAAATAATGCCAAAGCAGTTGTGAAAACCTTCCATGAAACCTTAGATTGTTGCGGCAGCAGTACCCTGACCGCACTGACCACCAGTGTGCTGAAAAATAATCTGTGCCCGAGCGGTAGCAATATTATTAGTAATCTGTTCAAGGAGGACTGCCATCAGAAAATTGATGATCTGTTCAGTGGCAAA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cytokeratin 8 Monoclonal Antibody
AN200190P 100 µL

Cytokeratin 8 Monoclonal Antibody

Sign In for Pricing
View Details
Bovine Thyroglobulin (TG) ELISA Kit
YP-W77691-01 48 Tests

Bovine Thyroglobulin (TG) ELISA Kit

Sign In for Pricing
View Details
Bovine Thyroglobulin (TG) ELISA Kit
YP-W77691-02 96 Tests

Bovine Thyroglobulin (TG) ELISA Kit

Sign In for Pricing
View Details
ANKRD10 Knockout HT29 Polyclonal Cells
ARG32944 1 Million

ANKRD10 Knockout HT29 Polyclonal Cells

Sign In for Pricing
View Details
CBX5 (Chromobox Protein Homolog 5, Antigen p25, Heterochromatin Protein 1 Homolog alpha, HP1 alpha, HP1alpha, HP1A)
309483-01 50 µg

CBX5 (Chromobox Protein Homolog 5, Antigen p25, Heterochromatin Protein 1 Homolog alpha, HP1 alpha, HP1alpha, HP1A)

Sign In for Pricing
View Details
CBX5 (Chromobox Protein Homolog 5, Antigen p25, Heterochromatin Protein 1 Homolog alpha, HP1 alpha, HP1alpha, HP1A)
309483-02 100 µg

CBX5 (Chromobox Protein Homolog 5, Antigen p25, Heterochromatin Protein 1 Homolog alpha, HP1 alpha, HP1alpha, HP1A)

Sign In for Pricing
View Details