CD79B Recombinant Protein

The B cell antigen receptor (BCR) is composed of membrane immunoglobulin molecules non-covalently associated with the heterodimeric signaling component, CD79A and CD79B (also known as Igα and Igβ, respectively) . The presence of this receptor complex is essential for B cell development and function. Following antigen binding, CD79A/CD79B heterodimers are phosphorylated and initiate intracellular signaling through Src family kinases, Lyn, Blk, and Fyn, as well as Syk and Btk tyrosine kinases. The complexity of BCR signaling results in a variety of distinct cellular functions, such as proliferation, tolerance, apoptosis, and differentiation. BCR-antigen ligation also leads to internalization of the complex, trafficking to late endosomes, and antigen presentation in major histocompatibility molecules on the B cell surface. CD79B enhances the phosphorylation of CD79A. Alternatively spliced transcript variants encoding different isoforms of CD79B have been identified. CD79B is widely expressed on B cell malignancies and may serve as a target for therapeutic intervention.

GCTCGTAGTGAAGATCGTTATCGTAATCCGAAAGGTAGCGCCTGTAGCCGTATCTGGCAGAGTCCGCGCTTCATTGCACGCAAACGCGGCTTCACCGTTAAAATGCATTGTTATATGAACAGCGCCAGCGGTAATGTGAGTTGGCTGTGGAAACAGGAAATGGATGAAAATCCGCAGCAGCTGAAACTGGAAAAAGGCCGTATGGAAGAAAGTCAGAATGAAAGCCTGGCCACCCTGACCATTCAGGGCATTCGCTTCGAAGATAATGGCATCTACTTCTGTCAGCAGAAATGTAATAATACCAGTGAAGTGTATCAGGGCTGCGGTACCGAACTGCGTGTGATGGGCTTCAGTACCCTGGCACAGCTGAAACAGCGTAATACCCTGAAAGAT