CD79A Recombinant Protein
Product Specifications
Background
Antigen receptors found on the surface of B cells contain a heterodimeric signaling component composed of CD79A and CD79B, also known as Ig α and Ig β, respectively. Presence of this receptor complex is essential for B-cell development and function. Together these two proteins and the associated B cell receptor initiate intracellular signaling following antigen binding. An immunoreceptor tyrosine-based activation motif (ITAM) found in the CD79A intracellular region appears to be important for its function. Antigen binding precedes formation of the CD79A and CD79B heterodimer and subsequent activation of receptor associated kinases. Research has shown that CD79A is a marker for B-lineage lymphoblastic leukemia. Additionally, investigators have found that mutations in the CD79A (MB1) gene are associated with abnormally low levels of functional B cell receptors in some cases of chronic B cell lymphocytic leukemia.
CAS Number
9000-83-3
Swiss Prot
P11912
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~15kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
CTGTGGATGCATAAAGTGCCGGCCAGCCTGATGGTTAGCCTGGGCGAAGATGCACACTTCCAGTGTCCGCATAATAGTAGTAATAATGCAAATGTGACCTGGTGGCGCGTGCTGCATGGTAATTATACCTGGCCGCCGGAATTCCTGGGTCCGGGTGAAGATCCGAATGGTACCCTGATTATTCAGAATGTTAATAAAAGCCACGGCGGTATCTATGTGTGTCGTGTTCAGGAAGGCAATGAAAGTTATCAGCAGAGCTGTGGTACCTATCTGCGTGTTCGTCAGCCGCCGCCGCGCCCGTTCTTAGATATGGGTGAAGGTACCAAAAATCGT
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items
