Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD7 Recombinant Protein

Product Specifications

Background

CD7 is a type-I transmembrane glycoprotein belonging to the immunoglobulin superfamily. CD7 is one of the earliest surface markers to be expressed on the surface of developing T cells and its expression is maintained throughout maturation of multiple T cell subsets and NK cells. Engagement of CD7 through binding its ligand, SECTM1, has been shown to promote tyrosine phosphorylation of its cytoplasmic domain, recruitment of PI3K, and delivery of costimulatory signals for T cell activation. While CD7 is expressed on normal T cells, it is also highly expressed in a variety of T cell malignancies, which has poised it as a potential target of immunotherapy.

CAS Number

9000-83-3

Swiss Prot

P09564

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCACAGGAAGTGCAGCAGAGTCCGCATTGCACCACCGTTCCGGTTGGTGCCAGTGTTAATATTACCTGTAGTACCAGCGGCGGCCTGCGCGGCATCTATCTGCGCCAGCTGGGCCCGCAGCCGCAGGACATTATCTATTATGAAGATGGCGTTGTGCCGACCACCGATCGCCGCTTCCGCGGTCGTATTGACTTCAGTGGCAGCCAGGATAATCTGACCATTACCATGCATCGTCTGCAGCTGAGCGATACCGGCACCTATACCTGTCAGGCCATTACCGAAGTGAATGTGTATGGTAGCGGTACCCTGGTTCTGGTGACCGAAGAACAGAGCCAGGGCTGGCATCGCTGCAGTGATGCACCGCCGCGTGCAAGTGCACTGCCGGCACCTCCGACCGGTAGTGCACTGCCTGATCCGCAGACCGCAAGCGCACTGCCGGATCCGCCGGCTGCTAGTGCACTGCCA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Faropenem Sodium Salt Hemipentahydrate
TRC-F103300-25MG 25 mg

Faropenem Sodium Salt Hemipentahydrate

Sign In for Pricing
View Details
MSMB (NM_002443) Human Over-expression Lysate
LC400872 20 µg

MSMB (NM_002443) Human Over-expression Lysate

Sign In for Pricing
View Details
Pmel17 / gp100 / SILV (NKI-beteb), CF647 conjugate, 0.1mg/mL
BNC470226-100 1x 100 µL

Pmel17 / gp100 / SILV (NKI-beteb), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
ThioGlo1
TRC-T350765-50MG 50 mg

ThioGlo1

Sign In for Pricing
View Details
Betaine-d3 Hydrochloride
TRC-B325152-2.5MG 2.5 mg

Betaine-d3 Hydrochloride

Sign In for Pricing
View Details
VEGI (Vascular Endothelial Growth Inhibitor) (VEGI/1283), CF640R conjugate, 0.1mg/mL
BNC401283-500 1x 500 µL

VEGI (Vascular Endothelial Growth Inhibitor) (VEGI/1283), CF640R conjugate, 0.1mg/mL

Sign In for Pricing
View Details