Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD7 Recombinant Protein

Product Specifications

Background

CD7 is a type-I transmembrane glycoprotein belonging to the immunoglobulin superfamily. CD7 is one of the earliest surface markers to be expressed on the surface of developing T cells and its expression is maintained throughout maturation of multiple T cell subsets and NK cells. Engagement of CD7 through binding its ligand, SECTM1, has been shown to promote tyrosine phosphorylation of its cytoplasmic domain, recruitment of PI3K, and delivery of costimulatory signals for T cell activation. While CD7 is expressed on normal T cells, it is also highly expressed in a variety of T cell malignancies, which has poised it as a potential target of immunotherapy.

CAS Number

9000-83-3

Swiss Prot

P09564

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~24kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCACAGGAAGTGCAGCAGAGTCCGCATTGCACCACCGTTCCGGTTGGTGCCAGTGTTAATATTACCTGTAGTACCAGCGGCGGCCTGCGCGGCATCTATCTGCGCCAGCTGGGCCCGCAGCCGCAGGACATTATCTATTATGAAGATGGCGTTGTGCCGACCACCGATCGCCGCTTCCGCGGTCGTATTGACTTCAGTGGCAGCCAGGATAATCTGACCATTACCATGCATCGTCTGCAGCTGAGCGATACCGGCACCTATACCTGTCAGGCCATTACCGAAGTGAATGTGTATGGTAGCGGTACCCTGGTTCTGGTGACCGAAGAACAGAGCCAGGGCTGGCATCGCTGCAGTGATGCACCGCCGCGTGCAAGTGCACTGCCGGCACCTCCGACCGGTAGTGCACTGCCTGATCCGCAGACCGCAAGCGCACTGCCGGATCCGCCGGCTGCTAGTGCACTGCCA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human ULK3 activation kit by CRISPRa
GA108679 1 Kit

Human ULK3 activation kit by CRISPRa

Sign In for Pricing
View Details
Purified Anti-Human CD40 Antibody
RD22252F-01 25 µg

Purified Anti-Human CD40 Antibody

Sign In for Pricing
View Details
Purified Anti-Human CD40 Antibody
RD22252F-02 100 µg

Purified Anti-Human CD40 Antibody

Sign In for Pricing
View Details
Peroxiredoxin 4 (Prognostic Marker for Lung SqCC) (CPTC-PRDX4-2), CF594 conjugate, 0.1mg/mL
BNC942483-100 1x 100 µL

Peroxiredoxin 4 (Prognostic Marker for Lung SqCC) (CPTC-PRDX4-2), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
MTMR7 Polyclonal Antibody
E-AB-10890-01 20 µL

MTMR7 Polyclonal Antibody

Sign In for Pricing
View Details
MTMR7 Polyclonal Antibody
E-AB-10890-02 60 µL

MTMR7 Polyclonal Antibody

Sign In for Pricing
View Details