Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD63 Recombinant Protein

Product Specifications

Background

CD63 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. CD63, like other tetraspanins, is enriched in exosomes. It is also a component of Weibel-Palade bodies found in endothelial cells. Research studies demonstrate several functions of CD63 in different cell types including roles in mast cell degranulation, VEGF signaling in endothelial cells, recruitment of leukocytes to endothelial cells, and endosomal sorting during melanogenesis.

CAS Number

9000-83-3

Swiss Prot

P08962

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~11kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTGGTTATGTGTTCCGTGATAAAGTTATGAGCGAATTCAATAATAACTTCCGTCAGCAGATGGAAAATTATCCGAAAAATAATCACACCGCAAGCATTCTGGATCGCATGCAGGCCGACTTCAAATGTTGTGGCGCAGCAAATTATACCGATTGGGAAAAAATTCCGAGCATGAGCAAAAATCGTGTGCCGGATAGCTGCTGCATTAATGTTACCGTTGGTTGCGGTATTAACTTCAATGAAAAAGCCATTCATAAGGAAGGTTGCGTTGAAAAAATTGGTGGTTGGCTGCGTAAAAATGTT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD63 (Late Endosomes Marker) (LAMP3/2881), CF488A conjugate, 0.1mg/mL
BNC882881-500 1x 500 µL

CD63 (Late Endosomes Marker) (LAMP3/2881), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details
IL36A Mouse
OM296394-01 10 µg

IL36A Mouse

Sign In for Pricing
View Details
IL36A Mouse
OM296394-02 2 µg

IL36A Mouse

Sign In for Pricing
View Details
IL36A Mouse
OM296394-03 1 mg

IL36A Mouse

Sign In for Pricing
View Details
ROR2 (ROR2/1911), Biotin conjugate, 0.1mg/mL
BNCB1911-500 1x 500 µL

ROR2 (ROR2/1911), Biotin conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Elab Fluor® 647 Anti-Mouse CD16/32 Antibody[2.4G2]
E-AB-F0997M-01 50 Tests

Elab Fluor® 647 Anti-Mouse CD16/32 Antibody[2.4G2]

Sign In for Pricing
View Details