Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD63 Recombinant Protein

Product Specifications

Background

CD63 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2) . Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. CD63, like other tetraspanins, is enriched in exosomes. It is also a component of Weibel-Palade bodies found in endothelial cells. Research studies demonstrate several functions of CD63 in different cell types including roles in mast cell degranulation, VEGF signaling in endothelial cells, recruitment of leukocytes to endothelial cells, and endosomal sorting during melanogenesis.

CAS Number

9000-83-3

Swiss Prot

P08962

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~11kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GCTGGTTATGTGTTCCGTGATAAAGTTATGAGCGAATTCAATAATAACTTCCGTCAGCAGATGGAAAATTATCCGAAAAATAATCACACCGCAAGCATTCTGGATCGCATGCAGGCCGACTTCAAATGTTGTGGCGCAGCAAATTATACCGATTGGGAAAAAATTCCGAGCATGAGCAAAAATCGTGTGCCGGATAGCTGCTGCATTAATGTTACCGTTGGTTGCGGTATTAACTTCAATGAAAAAGCCATTCATAAGGAAGGTTGCGTTGAAAAAATTGGTGGTTGGCTGCGTAAAAATGTT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

At1g47840 Antibody
orb790958 2 mg

At1g47840 Antibody

Sign In for Pricing
View Details
PCMV-APPL2-3xFLAG-Neo Plasmid
PVT71079 2 µg

PCMV-APPL2-3xFLAG-Neo Plasmid

Sign In for Pricing
View Details
Canine Matrix metalloproteinase 2 ELISA Kit
MBS743684-01 48 Well

Canine Matrix metalloproteinase 2 ELISA Kit

Sign In for Pricing
View Details
Canine Matrix metalloproteinase 2 ELISA Kit
MBS743684-02 96 Well

Canine Matrix metalloproteinase 2 ELISA Kit

Sign In for Pricing
View Details
Canine Matrix metalloproteinase 2 ELISA Kit
MBS743684-03 5x 96 Well

Canine Matrix metalloproteinase 2 ELISA Kit

Sign In for Pricing
View Details
Canine Matrix metalloproteinase 2 ELISA Kit
MBS743684-04 10x 96 Well

Canine Matrix metalloproteinase 2 ELISA Kit

Sign In for Pricing
View Details