Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD59 Recombinant Protein

Product Specifications

Background

CD59 is a GPI-anchored membrane protein that functions as inhibitor of the complement membrane attack complex (MAC) . CD59 binds to complement components C8 and C9, preventing C9 polymerization and insertion into membranes, therefore inhibiting the complement-dependent cytolysis (CDC) . CD59 is a ubiquitously expressed cell membrane protein that protects cells from CDC. Rare cases of CD59 deficiency have been reported to cause paroxysmal nocturnal hemoglobinuria in human patients. Expression of CD59 on tumor cells and viral infected cells makes them resist antibody-dependent complement-mediated lysis. Potent inhibitors for CD59 have been actively pursued for therapeutic applications. In addition, CD59 may regulate insulin secretion by modulating exocytosis.

CAS Number

9000-83-3

Swiss Prot

P13987

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~9kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CTGCAGTGTTATAATTGTCCGAATCCGACCGCAGATTGTAAAACCGCCGTGAATTGTAGTAGTGACTTCGATGCATGTCTGATTACCAAAGCAGGCCTGCAGGTGTATAATAAATGCTGGAAATTCGAACATTGCAACTTCAATGATGTTACCACCCGCCTGCGCGAAAATGAACTGACCTATTATTGCTGTAAAAAGGATCTGTGCAACTTCAACGAACAGCTGGAAAAT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

OAAF06988-100UG - PSMD2 Antibody
OAAF06988-100UG 100 µg

OAAF06988-100UG - PSMD2 Antibody

Sign In for Pricing
View Details
USP35 sgRNA CRISPR Lentivector (Human) (Target 1)
K2600402 1.0 µg DNA

USP35 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
PPP4R2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1709702 1.0 µg DNA

PPP4R2 sgRNA CRISPR Lentivector (Human) (Target 1)

Sign In for Pricing
View Details
Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit
MBS9394955-01 48 Well

Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit

Sign In for Pricing
View Details
Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit
MBS9394955-02 96 Well

Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit

Sign In for Pricing
View Details
Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit
MBS9394955-03 5x 96 Well

Bovine Keratin, Type II Cytoskeletal 3 (KRT3) ELISA Kit

Sign In for Pricing
View Details