Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD57 Recombinant Protein

Product Specifications

Background

Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (B3GAT1), also known as beta-1,3-glucuronyltransferase 1 and glucuronosyltransferase P, is a type II membrane protein enzyme encoded by the B3GAT1 gene. This gene is localized on the 11q25 chromosome and is a member of the glucuronyltransferase gene family. B3GAT1 is one of the enzymes involved in the biosynthesis of carbohydrate epitope human natural killer-1 (HNK-1), also known as CD57 and Leu7. B3GAT1 catalyzes the glucuronyl transfer reaction that adds a glucuronic acid to the terminal N-acetyllactosamine (Lac) disaccharide to form the CD57 epitope on a variety of proteins, lipids, and chondroitin sulfate proteoglycans at the cell surface. CD57 is present on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, as well as neural cells and striated muscle. The CD57 epitope may play a role in neural cell adhesion, and characterizes unique maturation states in T and NK cells.

CAS Number

9000-83-3

Swiss Prot

Q9P2W7

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~35kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

ACCCTGGCTCCGCTGCTGGCAGTTCATAAAGATGAAGGTAGTGATCCGCGTCGTGAAACACCTCCGGGTGCCGATCCGCGCGAATATTGCACCAGTGATCGCGATATTGTGGAAGTTGTGCGTACCGAATATGTGTATACCCGTCCGCCGCCGTGGAGTGATACCCTGCCGACCATTCATGTGGTTACCCCGACCTATAGTCGTCCGGTTCAGAAAGCAGAACTGACCCGTATGGCCAATACCCTGCTGCATGTTCCGAATCTGCATTGGCTGGTTGTGGAAGATGCCCCGCGCCGCACCCCGTTAACCGCTAGACTGCTGCGTGATACCGGTCTGAATTATACCCATCTGCATGTGGAAACACCTCGTAATTATAAACTGCGTGGCGATGCCCGTGATCCGCGTATTCCGCGCGGTACCATGCAGCGCAATCTGGCCCTGCGTTGGCTGCGTGAAACCTTCCCGCGTAATAGCAGCCAGCCGGGTGTGGTGTACTTCGCCGATGATGATAATACCTATAGTCTGGAACTGTTCGAAGAAATGCGTAGTACCCGTCGCGTTAGTGTGTGGCCGGTGGCATTCGTGGGCGGCCTGCGTTATGAAGCACCGCGCGTGAATGGTGCAGGTAAAGTTGTGGGCTGGAAAACCGTGTTCGATCCGCATCGCCCGTTCGCAATTGATATGGCCGGCTTCGCCGTGAATCTGCGTCTGATTCTGCAGCGTAGCCAGGCCTACTTCAAACTGCGTGGTGTTAAAGGTGGTTATCAGGAAAGCAGCCTGCTGCGCGAACTGGTTACCCTGAATGATCTGGAACCGAAAGCAGCCAATTGTACCAAAATTCTGGTGTGGCATACCCGTACCGAAAAACCGGTGCTGGTTAATGAAGGCAAAAAAGGCTTCACCGATCCGAGCGTGGAAATT

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

PI4KIIIbeta-IN-9 50mg
A16270-50 50 mg

PI4KIIIbeta-IN-9 50mg

Sign In for Pricing
View Details
Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)
S0B1541-01 1 mL

Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)

Sign In for Pricing
View Details
Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)
S0B1541-02 25 µL

Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)

Sign In for Pricing
View Details
Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)
S0B1541-03 100 µL

Alexa Fluor® 647 Rabbit Anti-Human CD80 Antibody (S-288-177)

Sign In for Pricing
View Details
CD305 (Leukocyte-associated Immunoglobulin-like Receptor 1, LAIR1, LAIR-1, hLAIR1) (Biotin)
124602-Biotin 100 µL

CD305 (Leukocyte-associated Immunoglobulin-like Receptor 1, LAIR1, LAIR-1, hLAIR1) (Biotin)

Sign In for Pricing
View Details
Human PPHLN1 knockdown cell line
ABC-KD11962 1 Vial

Human PPHLN1 knockdown cell line

Sign In for Pricing
View Details