CD57 Recombinant Protein
Product Specifications
Background
Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 (B3GAT1), also known as beta-1,3-glucuronyltransferase 1 and glucuronosyltransferase P, is a type II membrane protein enzyme encoded by the B3GAT1 gene. This gene is localized on the 11q25 chromosome and is a member of the glucuronyltransferase gene family. B3GAT1 is one of the enzymes involved in the biosynthesis of carbohydrate epitope human natural killer-1 (HNK-1), also known as CD57 and Leu7. B3GAT1 catalyzes the glucuronyl transfer reaction that adds a glucuronic acid to the terminal N-acetyllactosamine (Lac) disaccharide to form the CD57 epitope on a variety of proteins, lipids, and chondroitin sulfate proteoglycans at the cell surface. CD57 is present on a subset of peripheral blood lymphocytes, including NK cells and CD8+ T cells, as well as neural cells and striated muscle. The CD57 epitope may play a role in neural cell adhesion, and characterizes unique maturation states in T and NK cells.
CAS Number
9000-83-3
Swiss Prot
Q9P2W7
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~35kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
ACCCTGGCTCCGCTGCTGGCAGTTCATAAAGATGAAGGTAGTGATCCGCGTCGTGAAACACCTCCGGGTGCCGATCCGCGCGAATATTGCACCAGTGATCGCGATATTGTGGAAGTTGTGCGTACCGAATATGTGTATACCCGTCCGCCGCCGTGGAGTGATACCCTGCCGACCATTCATGTGGTTACCCCGACCTATAGTCGTCCGGTTCAGAAAGCAGAACTGACCCGTATGGCCAATACCCTGCTGCATGTTCCGAATCTGCATTGGCTGGTTGTGGAAGATGCCCCGCGCCGCACCCCGTTAACCGCTAGACTGCTGCGTGATACCGGTCTGAATTATACCCATCTGCATGTGGAAACACCTCGTAATTATAAACTGCGTGGCGATGCCCGTGATCCGCGTATTCCGCGCGGTACCATGCAGCGCAATCTGGCCCTGCGTTGGCTGCGTGAAACCTTCCCGCGTAATAGCAGCCAGCCGGGTGTGGTGTACTTCGCCGATGATGATAATACCTATAGTCTGGAACTGTTCGAAGAAATGCGTAGTACCCGTCGCGTTAGTGTGTGGCCGGTGGCATTCGTGGGCGGCCTGCGTTATGAAGCACCGCGCGTGAATGGTGCAGGTAAAGTTGTGGGCTGGAAAACCGTGTTCGATCCGCATCGCCCGTTCGCAATTGATATGGCCGGCTTCGCCGTGAATCTGCGTCTGATTCTGCAGCGTAGCCAGGCCTACTTCAAACTGCGTGGTGTTAAAGGTGGTTATCAGGAAAGCAGCCTGCTGCGCGAACTGGTTACCCTGAATGATCTGGAACCGAAAGCAGCCAATTGTACCAAAATTCTGGTGTGGCATACCCGTACCGAAAAACCGGTGCTGGTTAATGAAGGCAAAAAAGGCTTCACCGATCCGAGCGTGGAAATT
Available Sizes
More Discoveries
Explore Other Products
Browse additional items from our catalog