Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD5 Recombinant Protein

Product Specifications

Background

CD5 is a type-I transmembrane protein belonging to the scavenger receptor cysteine-rich (SRCR) family, characterized by the presence of at least one SRCR domain of 90-110 amino acids. CD5 is expressed by all mature T cells, the B-1a subset of mature B cells, and some leukemic B cells. Its expression is increased in regulatory T and B cells (Tregs/Bregs) . Anergic T and B cells also have elevated CD5 expression. Elevated levels of CD5 are also found in many autoimmune disorders. CD5 is associated with the T cell receptor (TCR) and negatively modulates T cell activation and differentiation. CD5 expression on the tumor infiltrating T lymphocytes is inversely correlated with their antitumor activity. Recently it was reported that CD5 directly binds to IL6 and can mediate downstream signaling. CD5+ B cells promote tumor growth in animal models. Reagents targeting CD5 have been actively pursued as therapeutic interventions for cancer and other conditions.

CAS Number

9000-83-3

Swiss Prot

P06127

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~38kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CGTCTGAGTTGGTATGATCCGGACTTCCAGGCACGCCTGACCCGCAGTAATAGTAAATGTCAGGGTCAGCTGGAAGTGTATCTGAAAGATGGCTGGCACATGGTGTGTAGCCAGAGCTGGGGTCGTAGCAGTAAACAGTGGGAAGATCCGAGCCAGGCCAGTAAAGTGTGTCAGCGTCTGAATTGTGGTGTGCCGCTGAGTCTGGGCCCGTTCCTGGTTACCTATACCCCGCAGAGCAGCATTATCTGTTATGGCCAGCTGGGTAGCTTCAGTAATTGTAGTCATAGTCGCAATGATATGTGCCATAGTCTGGGTCTGACCTGCCTGGAACCGCAGAAAACCACCCCGCCGACCACCCGTCCGCCGCCTACCACCACACCGGAACCGACCGCACCGCCGCGTCTGCAACTGGTTGCACAGAGCGGCGGCCAGCATTGTGCAGGCGTGGTGGAATTCTATAGCGGTAGCCTGGGCGGTACCATTAGTTATGAAGCACAGGATAAAACACAAGATCTGGAAAACTTCCTGTGTAATAATCTGCAGTGTGGCAGCTTCCTGAAACATCTGCCGGAAACCGAAGCCGGTCGTGCACAGGATCCGGGTGAACCGCGTGAACATCAGCCGCTGCCGATTCAGTGGAAAATTCAGAATAGTAGTTGCACCAGCCTGGAACATTGCTTCCGCAAAATTAAACCGCAGAAAAGCGGCCGCGTTCTGGCCCTGCTGTGTAGCGGCTTCCAGCCGAAAGTGCAGAGTCGCCTGGTTGGCGGTAGTAGTATCTGTGAAGGTACCGTTGAAGTTCGCCAGGGTGCACAGTGGGCAGCACTGTGCGATAGTAGTAGTGCCCGCAGCAGCCTGCGCTGGGAAGAAGTGTGTCGTGAACAGCAGTGTGGCTCAGTGAATAGTTATCGCGTTCTGGATGCAGGTGATCCGACCAGTCGTGGTCTGTTCTGTCCGCATCAGAAACTGAGCCAGTGTCATGAACTGTGGGAACGTAATAGCTATTGTAAAAAAGTGTTCGTTACCTGCCAGGATCCGAATCCG

Available Sizes

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-01 0.02 mg (E-Coli)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details
Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-02 0.1 mg (E-Coli)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details
Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-03 0.02 mg (Yeast)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details
Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-04 0.1 mg (Yeast)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details
Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-05 0.02 mg (Baculovirus)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details
Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)
MBS1162056-06 0.02 mg (Mammalian-Cell)

Recombinant Yersinia pestis bv. Antiqua UPF0115 protein YpAngola_A0379 (YpAngola_A0379)

Sign In for Pricing
View Details