Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD48 Recombinant Protein

Product Specifications

Background

CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecule (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregulated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regulates natural killer (NK) and CD8 T cell activation and cytolytic function.

CAS Number

9000-83-3

Swiss Prot

P09326

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~21kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ODC-1 (Ornithine Decarboxylase-1) (ODC1/486), Biotin conjugate, 0.1mg/mL
BNCB0486-500 1x 500 µL

ODC-1 (Ornithine Decarboxylase-1) (ODC1/486), Biotin conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD117 / c-Kit (Marker for Gastrointestinal Stromal Tumors) (KIT/2673), CF647 conjugate, 0.1mg/mL
BNC472673-100 1x 100 µL

CD117 / c-Kit (Marker for Gastrointestinal Stromal Tumors) (KIT/2673), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
3-Nitrophenol
TRC-N496935-25G 25 g

3-Nitrophenol

Sign In for Pricing
View Details
Syntaxin 1a (STX1A) Mouse Monoclonal Antibody [Clone ID: OTI7E2]
CF812841 100 µg

Syntaxin 1a (STX1A) Mouse Monoclonal Antibody [Clone ID: OTI7E2]

Sign In for Pricing
View Details
Recombinant Nesprin1 Antibody
RC-15705-01 50 μL

Recombinant Nesprin1 Antibody

Sign In for Pricing
View Details
Recombinant Nesprin1 Antibody
RC-15705-02 100 µL

Recombinant Nesprin1 Antibody

Sign In for Pricing
View Details