Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD48 Recombinant Protein

Product Specifications

Background

CD48 is a glycosylphosphatidylinositol (GPI) -anchored membrane protein of the signaling lymphocyte activation molecule (SLAM) family, also known as SLAMF2 and BLAST-1. It is constitutively expressed on most hematopoietic cells (not on neutrophils and a subset of long-term hematopoietic stem cells in mice) and can be upregulated under certain conditions like infection. Interaction with its low affinity ligand CD2 promotes adhesion and TCR signaling. Interaction with the high affinity ligand CD244 (2B4) regulates natural killer (NK) and CD8 T cell activation and cytolytic function.

CAS Number

9000-83-3

Swiss Prot

P09326

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~21kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGGGTCATCTGGTTCACATGACCGTTGTGAGCGGTAGCAATGTTACCCTGAATATTAGCGAAAGCCTGCCGGAAAATTATAAACAGCTGACCTGGTTCTATACCTTCGATCAGAAAATTGTGGAATGGGATAGTCGTAAAAGTAAATACTTCGAAAGCAAATTCAAGGGCCGTGTGCGTCTGGATCCGCAGAGCGGCGCCCTGTATATTAGCAAAGTTCAGAAAGAAGATAACAGTACCTATATTATGCGCGTGCTGAAAAAAACCGGTAATGAACAGGAATGGAAAATTAAACTGCAGGTGCTGGATCCGGTGCCGAAACCGGTTATTAAAATTGAAAAAATCGAGGATATGGACGATAATTGTTATCTGAAACTGAGTTGCGTGATTCCGGGTGAAAGCGTTAATTATACCTGGTATGGCGATAAACGTCCGTTCCCGAAAGAACTGCAGAATAGCGTTCTGGAAACCACCCTGATGCCGCATAATTATAGTCGCTGTTATACCTGTCAGGTTAGTAATAGTGTTAGCAGCAAAAATGGTACCGTGTGTCTGAGTCCGCCGTGTACCCTGGCACGTAGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ZNF541 antibody
FNab09712 100 µg

ZNF541 antibody

Sign In for Pricing
View Details
1-(1,6-Dihydro-6-oxo-1-phenyl-3-pyridinecarboxylate)-β-D-glucopyranuronic Acid
TRC-D181233-50MG 50 mg

1-(1,6-Dihydro-6-oxo-1-phenyl-3-pyridinecarboxylate)-β-D-glucopyranuronic Acid

Sign In for Pricing
View Details
CBLL2 antibody
FNab09722 100 µg

CBLL2 antibody

Sign In for Pricing
View Details
5-(Ethoxycarbonyl)thiophene-3-boronic Acid
TRC-E895058-500MG 500 mg

5-(Ethoxycarbonyl)thiophene-3-boronic Acid

Sign In for Pricing
View Details
CEP55 Antibody
KC-2830-01 50 μL

CEP55 Antibody

Sign In for Pricing
View Details
CEP55 Antibody
KC-2830-02 100 µL

CEP55 Antibody

Sign In for Pricing
View Details