Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD47 Recombinant Protein

Product Specifications

Background

CD47 is a five-pass transmembrane protein expressed on all normal cells. It binds to the SIRPa that is expressed on myeloid cells including macrophages, and neuronal cells in the central nervous system. Binding of CD47 to SIRPα promotes phosphorylation of tyrosine residues in the immunoreceptor tyrosine-based inhibitory motifs (ITIM) within the SIRPα cytoplasmic tail, inhibiting macrophage phagocytosis towards CD47-expressing cells. In this way, CD47 serves as "don't eat me" signal or a marker of "self", functioning as an innate immune checkpoint. Additionally, CD47 was reported to modulate lymphocyte cell activation and proliferation. CD47 is over-expressed in many types of cancer. The expression level of CD47 on cancer cells is negatively associated with the response to therapies, and low expression on tumor cells is associated with a better prognosis and survival. Reagents that can block CD47-SIRPα interaction are being actively pursued for therapeutic applications. In addition to SIRPα, other proteins have been reported to bind to CD47. Thrombospondin 1 (TSP1) competes with SIRPα to bind to CD47 in the extracellular region and activates signaling pathways downstream CD47. CD47 can laterally associate with VEGFR2, FAS, and certain integrins in different contexts, and influences their downstream signaling. CD47 can be shed from the cell surface by proteolytic cleavage. In addition, CD47 is present on extracellular vesicles including exosomes, suggesting additional extracellular signaling potential.CD47 is a five-pass transmembrane protein expressed on all normal cells. It binds to the SIRPa that is expressed on myeloid cells including macrophages, and neuronal cells in the central nervous system. Binding of CD47 to SIRPα promotes phosphorylation of tyrosine residues in the immunoreceptor tyrosine-based inhibitory motifs (ITIM) within the SIRPα cytoplasmic tail, inhibiting macrophage phagocytosis towards CD47-expressing cells. In this way, CD47 serves as "don't eat me" signal or a marker of "self", functioning as an innate immune checkpoint. Additionally, CD47 was reported to modulate lymphocyte cell activation and proliferation. CD47 is over-expressed in many types of cancer. The expression level of CD47 on cancer cells is negatively associated with the response to therapies, and low expression on tumor cells is associated with a better prognosis and survival. Reagents that can block CD47-SIRPα interaction are being actively pursued for therapeutic applications. In addition to SIRPα, other proteins have been reported to bind to CD47. Thrombospondin 1 (TSP1) competes with SIRPα to bind to CD47 in the extracellular region and activates signaling pathways downstream CD47. CD47 can laterally associate with VEGFR2, FAS, and certain integrins in different contexts, and influences their downstream signaling. CD47 can be shed from the cell surface by proteolytic cleavage. In addition, CD47 is present on extracellular vesicles including exosomes, suggesting additional extracellular signaling potential.

CAS Number

9000-83-3

Swiss Prot

Q08722

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~15kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CAGCTGCTGTTCAATAAAACCAAAAGCGTGGAATTCACCTTCTGCAATGATACCGTGGTGATTCCGTGCTTCGTGACCAATATGGAAGCCCAGAATACCACCGAAGTGTATGTGAAATGGAAATTCAAAGGTCGTGATATCTATACCTTCGATGGTGCACTGAATAAAAGCACCGTGCCGACCGACTTCAGCAGTGCAAAAATTGAAGTGAGCCAGCTGCTGAAAGGTGATGCAAGTCTGAAAATGGATAAAAGCGATGCAGTTAGTCATACCGGTAATTATACCTGCGAAGTGACCGAACTGACCCGTGAAGGCGAAACCATTATTGAACTGAAATATCGTGTTGTGAGTTGGTTCAGCCCGAATGAA

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD8 (RIV11), CF640R conjugate, 0.1mg/mL
BNC400333-500 1x 500 µL

CD8 (RIV11), CF640R conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD104 (UM-A9), CF488A conjugate, 0.1mg/mL
BNC880449-100 1x 100 µL

CD104 (UM-A9), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details
CD34 (ICO-115), CF594 conjugate, 0.1mg/mL
BNC940039-500 1x 500 µL

CD34 (ICO-115), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
TNF alpha (J2D10), CF647 conjugate, 0.1mg/mL
BNC470994-100 1x 100 µL

TNF alpha (J2D10), CF647 conjugate, 0.1mg/mL

Sign In for Pricing
View Details