Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD40L Recombinant Protein

Product Specifications

Background

CD40 ligand (CD40L), also known as CD154, TRAP, and gp39, is the ligand for the TNF receptor family member CD40. CD40L is expressed either as a soluble cytokine or as a homotrimeric transmembrane protein. CD40L primarily expressed on the surface of T-cells, but has also been reported in blood platelets, mast cells, basophils, NK cells, and B-cells. It plays an important role in stimulating B-cell cell proliferation and survival and promotes immunoglobulin class switching and secretion of IgE. Signals generated by CD40 vary depending on cell type and include activation of MAPK pathways as well as NF-κB. Mutations within the CD40L gene are associated with X-linked hyper-IgM syndrome characterized by high serum levels of IgM and decreased levels of other isotypes. The CD40L/CD40 pathway is an important area of interest in the study of cancer, vascular diseases, and inflammatory disorders.

CAS Number

9000-83-3

Swiss Prot

P29965

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~30kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

CATCGTCGCCTGGATAAAATTGAAGATGAACGTAATCTGCATGAAGACTTCGTGTTCATGAAAACCATTCAGCGTTGCAATACCGGTGAACGTAGTCTGAGTCTGCTGAATTGCGAAGAAATTAAAAGTCAGTTCGAAGGCTTCGTTAAAGATATTATGCTGAATAAAGAGGAGACCAAAAAAGAAAATAGCTTCGAAATGCAGAAGGGTGATCAGAATCCGCAGATTGCAGCCCATGTGATTAGTGAAGCCAGTAGTAAAACCACCAGTGTGCTGCAGTGGGCCGAAAAAGGTTATTATACCATGAGCAATAACCTGGTTACCCTGGAAAATGGTAAACAGCTGACCGTGAAACGTCAGGGCCTGTATTATATCTATGCACAGGTGACCTTCTGCAGTAATCGTGAAGCCAGCAGTCAGGCACCGTTCATTGCAAGTCTGTGTCTGAAAAGTCCGGGCCGCTTCGAACGTATTCTGCTGCGCGCAGCCAATACCCATAGTAGCGCCAAACCGTGCGGTCAGCAGAGCATTCATCTGGGCGGTGTGTTCGAACTGCAGCCGGGTGCCAGTGTGTTCGTGAATGTTACCGATCCGAGTCAGGTTAGCCATGGTACCGGCTTCACCAGCTTCGGCCTGCTGAAACTG

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cytochrome b5 Polyclonal Antibody
E-AB-14924-01 20 µL

Cytochrome b5 Polyclonal Antibody

Sign In for Pricing
View Details
Cytochrome b5 Polyclonal Antibody
E-AB-14924-02 60 µL

Cytochrome b5 Polyclonal Antibody

Sign In for Pricing
View Details
Cytochrome b5 Polyclonal Antibody
E-AB-14924-03 120 µL

Cytochrome b5 Polyclonal Antibody

Sign In for Pricing
View Details
Cytochrome b5 Polyclonal Antibody
E-AB-14924-04 200 µL

Cytochrome b5 Polyclonal Antibody

Sign In for Pricing
View Details
CD44v4 (Marker of Tumor Metastasis) (rCD44v4/1219), CF568 conjugate, 0.1mg/mL
BNC681932-100 1x 100 µL

CD44v4 (Marker of Tumor Metastasis) (rCD44v4/1219), CF568 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
MPST (NM_001130517) Human Over-expression Lysate
LC427224 20 µg

MPST (NM_001130517) Human Over-expression Lysate

Sign In for Pricing
View Details