Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD40 Recombinant Protein

Product Specifications

Background

CD40, also known as tumor necrosis factor receptor superfamily member 5 (TNFRSF5), is a type I transmembrane protein expressed on the surface of B cells and professional antigen-presenting cells of the immune system, as well as on several non-hematopoietic cell types and cancers. CD40 interacts with CD40 ligand (CD40L/TNFSF5), which is expressed primarily on activated T cells but has also been reported on blood platelets, mast cells, basophils, NK cells, and B cells. Upon engagement with CD40L, CD40 signals through TNF receptor associated factors and MAP kinase signaling pathways, resulting in a wide variety of immune and inflammatory responses, including dendritic cell activation and cross-presentation, T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. The CD40/CD40L axis is essential for the initiation and progression of cellular and humoral adaptive immunity, and is an important area of interest in the study of tumor immunology, neurodegenerative diseases, vascular diseases, and inflammatory disorders.

CAS Number

9000-83-3

Swiss Prot

P25942

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~25kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GAACCGCCTACCGCATGTCGTGAAAAACAGTATCTGATTAATAGCCAGTGTTGTAGCCTGTGCCAGCCGGGTCAGAAACTGGTGAGCGATTGCACCGAATTCACCGAAACCGAATGCCTGCCGTGCGGTGAAAGCGAATTCCTGGATACCTGGAATCGCGAAACACATTGTCATCAGCATAAATATTGTGATCCGAATCTGGGCCTGCGTGTGCAGCAGAAAGGCACCAGTGAAACCGATACCATCTGTACCTGTGAAGAAGGTTGGCATTGTACCAGCGAAGCATGCGAAAGTTGCGTGCTGCATCGTAGCTGCAGTCCGGGCTTCGGTGTGAAACAGATTGCCACCGGTGTGAGCGATACCATCTGTGAACCGTGCCCGGTTGGCTTCTTCAGTAATGTTAGTAGTGCATTCGAAAAATGCCATCCGTGGACCAGCTGTGAAACCAAAGATCTGGTTGTTCAGCAGGCAGGCACCAATAAAACCGATGTGGTGTGTGGCCCGCAGGATCGCCTGCGT

Available Sizes

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

(3S,5R)-6-Cyano-3,5-dihydroxy-hexanoic Acid tert-Butyl Ester
TRC-C955900-25MG 25 mg

(3S,5R)-6-Cyano-3,5-dihydroxy-hexanoic Acid tert-Butyl Ester

Sign In for Pricing
View Details
Recombinant Human Chitotriosidase/CHIT1 Protein (His Tag)
PKSH031194-01 50 µg

Recombinant Human Chitotriosidase/CHIT1 Protein (His Tag)

Sign In for Pricing
View Details
Recombinant Human Chitotriosidase/CHIT1 Protein (His Tag)
PKSH031194-02 500 µg

Recombinant Human Chitotriosidase/CHIT1 Protein (His Tag)

Sign In for Pricing
View Details
Tissue Total RNA, Colon
CR561313 5 µg

Tissue Total RNA, Colon

Sign In for Pricing
View Details
C5orf67 (NM_001287053) Human Tagged ORF Clone
RG235845 10 µg

C5orf67 (NM_001287053) Human Tagged ORF Clone

Sign In for Pricing
View Details
PDP1 (NM_001161781) Human Recombinant Protein
TP328947M 100 µg

PDP1 (NM_001161781) Human Recombinant Protein

Sign In for Pricing
View Details