CD40 Recombinant Protein
Product Specifications
Background
CD40, also known as tumor necrosis factor receptor superfamily member 5 (TNFRSF5), is a type I transmembrane protein expressed on the surface of B cells and professional antigen-presenting cells of the immune system, as well as on several non-hematopoietic cell types and cancers. CD40 interacts with CD40 ligand (CD40L/TNFSF5), which is expressed primarily on activated T cells but has also been reported on blood platelets, mast cells, basophils, NK cells, and B cells. Upon engagement with CD40L, CD40 signals through TNF receptor associated factors and MAP kinase signaling pathways, resulting in a wide variety of immune and inflammatory responses, including dendritic cell activation and cross-presentation, T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. The CD40/CD40L axis is essential for the initiation and progression of cellular and humoral adaptive immunity, and is an important area of interest in the study of tumor immunology, neurodegenerative diseases, vascular diseases, and inflammatory disorders.
CAS Number
9000-83-3
Swiss Prot
P25942
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~25kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GAACCGCCTACCGCATGTCGTGAAAAACAGTATCTGATTAATAGCCAGTGTTGTAGCCTGTGCCAGCCGGGTCAGAAACTGGTGAGCGATTGCACCGAATTCACCGAAACCGAATGCCTGCCGTGCGGTGAAAGCGAATTCCTGGATACCTGGAATCGCGAAACACATTGTCATCAGCATAAATATTGTGATCCGAATCTGGGCCTGCGTGTGCAGCAGAAAGGCACCAGTGAAACCGATACCATCTGTACCTGTGAAGAAGGTTGGCATTGTACCAGCGAAGCATGCGAAAGTTGCGTGCTGCATCGTAGCTGCAGTCCGGGCTTCGGTGTGAAACAGATTGCCACCGGTGTGAGCGATACCATCTGTGAACCGTGCCCGGTTGGCTTCTTCAGTAATGTTAGTAGTGCATTCGAAAAATGCCATCCGTGGACCAGCTGTGAAACCAAAGATCTGGTTGTTCAGCAGGCAGGCACCAATAAAACCGATGTGGTGTGTGGCCCGCAGGATCGCCTGCGT
Available Sizes
Frequently Asked Questions
More Discoveries
Explore Other Products
Browse additional items from our catalog