CD3G Recombinant Protein

The T cell antigen receptor (TCR) recognizes foreign antigens and translates such recognition events into intracellular signals that elicit a change in the cell from a dormant to an activated state. Much of this signaling process can be attributed to a multisubunit complex of proteins that associates directly with the TCR. This complex has been designated CD3 (cluster of differentiation 3) . It is composed of five invariant polypeptide chains that associate to form three dimers: a heterodimer of γ and ε chains (γε), a heterodimer of δ and ε chains (δε) and a homodimer of two ζ chains (ζζ) or a heterodimer of ζ and η chains (ζη) . The ζ and η chains are encoded by the same gene but differ in their carboxyl-terminal ends due to an alternative splicing event. The γ, ε and δ chains each contain a single copy of a conserved immunoreceptor tyrosinebased activation motif (ITAM) . In contrast, the ζ chain contains three consecutive copies of the same motif. Phosphorylated ITAMs act as docking sites for protein kinases such as ZAP-70 and Syk and are also capable of regulating their kinase activity. The crystal structure of the ZAP-70 SH2 domains bound to the ζ chain ITAMs has been solved.

CAGAGTATTAAGGGCAATCATCTGGTGAAAGTGTATGATTATCAGGAAGATGGCAGCGTGCTGCTGACCTGCGATGCCGAAGCCAAAAATATTACCTGGTTCAAAGATGGTAAGATGATTGGCTTCCTGACCGAAGATAAAAAAAAATGGAATCTGGGCAGCAATGCCAAAGATCCGCGCGGTATGTATCAGTGCAAAGGTAGCCAGAATAAAAGCAAACCGCTGCAGGTGTATTATCGCATGTGTCAGAATTGCATTGAACTGAATGCAGCAACCATTAGC