CD3E Recombinant Protein
Product Specifications
Background
When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM) . Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.
CAS Number
9000-83-3
Swiss Prot
P07766
Modification Site
NdeI-XhoI
Expression System
Pet-22b (+)
Tag
His-tag
Purity
Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .
Solubility
PBS, 4M Urea, PH7.4
Molecular Weight
~18kDa
Storage Conditions
Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Notes
For research use only, not for use in diagnostic procedure.
Host or Source
E.coli
AA Sequence
GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT
Available Sizes
Curated Selection
Explore Other Products
Discover premium biology products from our extensive collection of 20M+ items