Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CD3E Recombinant Protein

Product Specifications

Background

When T cells encounter antigens via the T cell receptor (TCR), information about the quantity and quality of antigens is relayed to the intracellular signal transduction machinery. This activation process depends mainly on CD3 (Cluster of Differentiation 3), a multiunit protein complex that directly associates with the TCR. CD3 is composed of four polypeptides: ζ, γ, ε and δ. Each of these polypeptides contains at least one immunoreceptor tyrosine-based activation motif (ITAM) . Engagement of TCR complex with foreign antigens induces tyrosine phosphorylation in the ITAM motifs and phosphorylated ITAMs function as docking sites for signaling molecules such as ZAP-70 and p85 subunit of PI-3 kinase. TCR ligation also induces a conformational change in CD3ε, such that a proline region is exposed and then associates with the adaptor protein Nck.

CAS Number

9000-83-3

Swiss Prot

P07766

Modification Site

NdeI-XhoI

Expression System

Pet-22b (+)

Tag

His-tag

Purity

Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE) .

Solubility

PBS, 4M Urea, PH7.4

Molecular Weight

~18kDa

Storage Conditions

Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Notes

For research use only, not for use in diagnostic procedure.

Host or Source

E.coli

AA Sequence

GATGGTAATGAAGAAATGGGCGGTATTACCCAGACCCCGTATAAAGTTAGTATTAGTGGCACCACCGTTATTCTGACCTGTCCGCAGTATCCGGGTAGCGAAATTCTGTGGCAGCATAATGATAAAAATATCGGCGGTGATGAAGATGATAAAAATATTGGTAGCGATGAAGATCATCTGAGTCTGAAAGAATTCAGTGAACTGGAACAGAGCGGTTATTATGTGTGTTATCCGCGCGGTAGTAAACCGGAAGATGCCAACTTCTATCTGTATCTGCGTGCACGCGTGTGTGAAAATTGTATGGAAATGGAT

Available Sizes

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Tmem104 AAV siRNA Pooled Vector
46857166 1.0 µg

Tmem104 AAV siRNA Pooled Vector

Ask
View Details
AKAP4 (NM_003886) Human Tagged ORF Clone Lentiviral Particle
RC221765L4V 200 µL

AKAP4 (NM_003886) Human Tagged ORF Clone Lentiviral Particle

Ask
View Details
Di-n-butyl phthalate
S-1770 1 mL

Di-n-butyl phthalate

Ask
View Details